Incidental Mutation 'R6784:Tmc1'
ID531584
Institutional Source Beutler Lab
Gene Symbol Tmc1
Ensembl Gene ENSMUSG00000024749
Gene Nametransmembrane channel-like gene family 1
Synonyms4933416G09Rik, Beethoven, Bth
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6784 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location20783458-20954202 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 20827651 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039500]
Predicted Effect probably null
Transcript: ENSMUST00000039500
SMART Domains Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749

DomainStartEndE-ValueType
SCOP:d1eq1a_ 2 95 3e-3 SMART
low complexity region 129 150 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
Pfam:TMC 512 627 2.6e-36 PFAM
transmembrane domain 632 654 N/A INTRINSIC
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Aass C T 6: 23,093,896 S142N probably null Het
Aida A G 1: 183,322,491 Y275C probably damaging Het
Arrdc4 A G 7: 68,748,846 I74T probably benign Het
C1ql4 A G 15: 99,087,409 V107A probably benign Het
Ccnh T C 13: 85,212,765 V284A probably benign Het
Cd180 A G 13: 102,702,705 E32G probably damaging Het
Chd6 T C 2: 160,966,254 D1680G probably damaging Het
Cog7 A T 7: 121,964,293 probably null Het
Cyp2j6 T A 4: 96,535,504 Q209L possibly damaging Het
Dars A T 1: 128,391,347 V116E probably damaging Het
Dnah10 A G 5: 124,777,826 K1932E probably damaging Het
Dock9 A G 14: 121,543,514 S2086P probably damaging Het
Espl1 C G 15: 102,299,225 R375G probably benign Het
Fer1l6 C T 15: 58,571,426 S526L possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gigyf2 G T 1: 87,443,674 V1170L probably damaging Het
Gm14412 G T 2: 177,317,340 T41K probably benign Het
Gm45861 A G 8: 27,500,058 probably null Het
Gm5640 C T X: 74,640,415 R355H probably damaging Homo
Hist1h2bc T C 13: 23,684,500 I90T probably damaging Het
Hoxc5 A G 15: 103,013,890 probably benign Het
Klra1 T C 6: 130,372,854 D207G probably benign Het
Lancl2 A G 6: 57,703,255 N57D probably benign Het
Map2k4 T C 11: 65,691,751 probably benign Het
Mgat3 G T 15: 80,212,200 Q409H probably damaging Het
Mpp3 T A 11: 102,002,148 probably null Het
Myh1 T A 11: 67,214,570 L1062Q probably damaging Het
Nebl T A 2: 17,434,914 K183* probably null Het
Npat G C 9: 53,558,158 D315H probably damaging Het
Nt5c2 A G 19: 46,924,327 V63A probably damaging Het
Olfr1123 C T 2: 87,418,452 R135C probably benign Het
Olfr389 T G 11: 73,776,850 H159P probably damaging Het
Olfr491 A T 7: 108,317,782 D296V probably damaging Het
Olfr574 A T 7: 102,948,515 T17S possibly damaging Het
Opn1sw T A 6: 29,379,847 E129D probably damaging Het
Prdm16 T C 4: 154,323,307 Y1153C probably damaging Het
Prdm6 T A 18: 53,536,626 D105E probably benign Het
Rbm27 T C 18: 42,301,864 M331T probably benign Het
S1pr1 A G 3: 115,712,061 Y295H probably damaging Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Sla2 C T 2: 156,883,669 S3N unknown Het
Slc10a6 A G 5: 103,629,030 I68T probably damaging Het
Slc5a1 T C 5: 33,158,116 F493S probably benign Het
Snx14 A T 9: 88,381,792 Y847N probably benign Het
Vps8 C A 16: 21,563,207 Q1130K probably benign Het
Other mutations in Tmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Tmc1 APN 19 20816192 missense probably damaging 1.00
IGL02104:Tmc1 APN 19 20832454 missense probably benign 0.00
IGL02245:Tmc1 APN 19 20799192 missense probably damaging 1.00
IGL02544:Tmc1 APN 19 20906963 missense probably benign 0.04
IGL02699:Tmc1 APN 19 20832350 critical splice donor site probably null
IGL02974:Tmc1 APN 19 20900844 missense probably benign
IGL03194:Tmc1 APN 19 20804653 missense probably damaging 1.00
R0255:Tmc1 UTSW 19 20789587 missense possibly damaging 0.93
R0381:Tmc1 UTSW 19 20799045 missense probably damaging 1.00
R0655:Tmc1 UTSW 19 20799176 missense probably damaging 1.00
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1496:Tmc1 UTSW 19 20868355 missense probably damaging 1.00
R1542:Tmc1 UTSW 19 20816122 missense probably damaging 1.00
R1773:Tmc1 UTSW 19 20826501 splice site probably null
R1777:Tmc1 UTSW 19 20816109 critical splice donor site probably null
R2067:Tmc1 UTSW 19 20824309 missense possibly damaging 0.90
R2152:Tmc1 UTSW 19 20856675 missense probably benign 0.01
R2180:Tmc1 UTSW 19 20824084 missense probably damaging 0.96
R2204:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2205:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2285:Tmc1 UTSW 19 20789799 missense probably damaging 0.96
R4505:Tmc1 UTSW 19 20868374 missense probably benign 0.00
R4752:Tmc1 UTSW 19 20826649 missense probably benign 0.35
R4975:Tmc1 UTSW 19 20906955 missense probably damaging 0.96
R5040:Tmc1 UTSW 19 20824030 missense possibly damaging 0.68
R5206:Tmc1 UTSW 19 20826660 missense probably damaging 1.00
R5400:Tmc1 UTSW 19 20804602 missense probably damaging 1.00
R5429:Tmc1 UTSW 19 20789622 missense possibly damaging 0.72
R6200:Tmc1 UTSW 19 20789590 missense possibly damaging 0.53
R6796:Tmc1 UTSW 19 20799036 missense probably damaging 1.00
R6808:Tmc1 UTSW 19 20795516 missense probably damaging 0.99
R6812:Tmc1 UTSW 19 20900861 missense probably damaging 1.00
R6834:Tmc1 UTSW 19 20795610 nonsense probably null
R6978:Tmc1 UTSW 19 20804635 missense probably damaging 1.00
R6986:Tmc1 UTSW 19 20824283 missense probably benign 0.02
R7027:Tmc1 UTSW 19 20940903 critical splice donor site probably null
R7378:Tmc1 UTSW 19 20868389 missense probably damaging 0.98
R7520:Tmc1 UTSW 19 20799178 missense not run
Predicted Primers PCR Primer
(F):5'- AGAGACAAAGATACAGCTGCTC -3'
(R):5'- ACAGTTTTCCCGTGACTGCTG -3'

Sequencing Primer
(F):5'- CAGCTGCTCTGGGTCAC -3'
(R):5'- TTTCTGGCTGCTGAATTACATTC -3'
Posted On2018-08-29