Incidental Mutation 'R6785:Gen1'
ID531640
Institutional Source Beutler Lab
Gene Symbol Gen1
Ensembl Gene ENSMUSG00000051235
Gene NameGEN1, Holliday junction 5' flap endonuclease
Synonyms5830483C08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6785 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location11238920-11265801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11262530 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 13 (V13A)
Ref Sequence ENSEMBL: ENSMUSP00000132098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020931] [ENSMUST00000166117] [ENSMUST00000217906] [ENSMUST00000218022] [ENSMUST00000218259] [ENSMUST00000218487] [ENSMUST00000218547] [ENSMUST00000218866] [ENSMUST00000219600] [ENSMUST00000219776]
Predicted Effect probably benign
Transcript: ENSMUST00000020931
SMART Domains Protein: ENSMUSP00000020931
Gene: ENSMUSG00000020608

DomainStartEndE-ValueType
Pfam:SMC_N 53 1077 4.7e-17 PFAM
Pfam:AAA_15 54 438 3.1e-9 PFAM
Pfam:AAA_23 56 398 5e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166117
AA Change: V13A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132098
Gene: ENSMUSG00000051235
AA Change: V13A

DomainStartEndE-ValueType
XPGN 1 96 9.13e-22 SMART
XPGI 122 193 5.32e-23 SMART
HhH2 195 229 2.87e-5 SMART
low complexity region 704 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217906
Predicted Effect probably benign
Transcript: ENSMUST00000218022
Predicted Effect probably benign
Transcript: ENSMUST00000218259
AA Change: V13A

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000218487
Predicted Effect probably benign
Transcript: ENSMUST00000218547
Predicted Effect probably benign
Transcript: ENSMUST00000218866
Predicted Effect probably benign
Transcript: ENSMUST00000219600
AA Change: V13A

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000219776
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rad2/xeroderma pigmentosum group G nuclease family, whose members are characterized by N-terminal and internal xeroderma pigmentosum group G nuclease domains followed by helix-hairpin-helix domains and disordered C-terminal domains. The protein encoded by this gene is involved in resolution of Holliday junctions, which are intermediate four-way structures that covalently link DNA during homologous recombination and double-strand break repair. The protein resolves Holliday junctions by creating dual incisions across the junction to produce nicked duplex products that can be ligated. In addition, this protein has been found to localize to centrosomes where it has been implicated in regulation of centrosome integrity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 A G 2: 22,953,467 V316A probably benign Het
Acad12 T C 5: 121,609,845 Y170C probably damaging Het
Acss2 T C 2: 155,560,685 V587A probably damaging Het
Adamtsl3 A G 7: 82,522,004 I422V probably damaging Het
AI481877 T C 4: 59,049,066 M1100V probably benign Het
Aldh18a1 A G 19: 40,568,344 L375P probably damaging Het
B020011L13Rik A G 1: 117,801,069 D102G possibly damaging Het
Cfap74 T A 4: 155,454,024 probably benign Het
Coa4 G A 7: 100,539,253 V58M probably damaging Het
Crybg1 T C 10: 43,999,171 N647S probably benign Het
D3Ertd254e T A 3: 36,165,452 C541* probably null Het
Dync1h1 G A 12: 110,629,679 G1547S probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Fasl T A 1: 161,781,835 Y194F probably benign Het
Fbxw8 T C 5: 118,092,689 E349G probably damaging Het
Gm4559 A G 7: 142,274,108 C86R unknown Het
H2-M9 T C 17: 36,642,233 N61D probably damaging Het
H6pd C T 4: 149,982,790 E380K possibly damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hnrnpd C A 5: 99,978,424 K67N probably benign Het
Hspg2 T C 4: 137,508,398 S170P probably damaging Het
Igsf10 G T 3: 59,319,244 P2336Q probably damaging Het
Itih3 C T 14: 30,912,615 probably null Het
Katnb1 T C 8: 95,095,642 Y298H probably benign Het
Kif21a A T 15: 90,935,730 N1610K probably damaging Het
Lce1l A T 3: 92,850,193 C119* probably null Het
Lcn2 C T 2: 32,387,027 probably null Het
Lmf2 A T 15: 89,352,033 S588T probably benign Het
Mboat7 A G 7: 3,685,836 L231P probably benign Het
Mier2 T C 10: 79,544,713 R288G probably damaging Het
Mybbp1a T C 11: 72,447,566 V694A probably benign Het
Ndnf C A 6: 65,703,063 L109I probably benign Het
Nfkb1 C A 3: 135,615,303 E230D probably benign Het
Nostrin A G 2: 69,183,927 K409R probably benign Het
Olfr1082 T A 2: 86,594,421 M136L probably damaging Het
Olfr338 A G 2: 36,376,842 Q22R probably benign Het
Olfr338 C A 2: 36,376,951 Y58* probably null Het
Pdpr C A 8: 111,124,611 T534N probably benign Het
Plekhf1 G A 7: 38,222,064 Q27* probably null Het
Ppp6c A T 2: 39,197,581 H204Q probably benign Het
Prrc2c T C 1: 162,709,101 probably benign Het
Prrg2 A G 7: 45,060,225 F83L probably damaging Het
Rab11fip3 T G 17: 25,991,718 D938A probably damaging Het
Rai1 A G 11: 60,188,794 N1228S probably benign Het
Ryr1 G T 7: 29,064,874 T3060K probably benign Het
Scube2 A G 7: 109,810,617 I557T probably benign Het
Setdb1 C A 3: 95,326,401 R1066L probably benign Het
Slc35f3 T C 8: 126,394,459 V353A probably benign Het
Slfn3 A T 11: 83,214,601 T475S possibly damaging Het
Snrnp200 T A 2: 127,229,165 M1122K possibly damaging Het
Tead4 T A 6: 128,242,481 K223* probably null Het
Tex2 A C 11: 106,533,950 I334R probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Tfdp1 G T 8: 13,377,233 V393F possibly damaging Het
Thsd7b T C 1: 129,430,907 L26P probably damaging Het
Trim80 T C 11: 115,441,201 I73T probably damaging Het
Tssk4 T A 14: 55,650,475 Y43N probably damaging Het
Ttn T C 2: 76,711,495 T25389A probably damaging Het
Ttn A T 2: 76,747,944 F24202I probably damaging Het
Vmn1r177 A G 7: 23,866,137 S105P probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Other mutations in Gen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Gen1 APN 12 11261067 missense probably damaging 1.00
IGL01308:Gen1 APN 12 11256870 missense probably damaging 1.00
IGL01384:Gen1 APN 12 11255241 missense probably benign 0.00
IGL01766:Gen1 APN 12 11256894 missense probably damaging 1.00
IGL02132:Gen1 APN 12 11241866 missense probably benign 0.37
IGL02191:Gen1 APN 12 11242296 missense probably benign 0.18
IGL02452:Gen1 APN 12 11242575 missense probably benign 0.02
IGL02479:Gen1 APN 12 11241935 missense probably benign 0.01
IGL02690:Gen1 APN 12 11241575 missense probably damaging 0.96
IGL03095:Gen1 APN 12 11248264 missense probably benign 0.38
PIT4520001:Gen1 UTSW 12 11241508 missense probably benign 0.12
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0355:Gen1 UTSW 12 11248354 splice site probably benign
R0680:Gen1 UTSW 12 11241869 missense probably benign 0.06
R0891:Gen1 UTSW 12 11248354 splice site probably benign
R1192:Gen1 UTSW 12 11255218 missense probably damaging 0.97
R1353:Gen1 UTSW 12 11243219 missense probably benign 0.00
R1833:Gen1 UTSW 12 11248351 splice site probably benign
R1898:Gen1 UTSW 12 11241608 missense probably benign 0.10
R2138:Gen1 UTSW 12 11241621 missense probably damaging 1.00
R2185:Gen1 UTSW 12 11261040 missense probably null 0.95
R2409:Gen1 UTSW 12 11249164 missense possibly damaging 0.75
R2876:Gen1 UTSW 12 11242068 missense probably benign 0.13
R3815:Gen1 UTSW 12 11252033 missense possibly damaging 0.84
R4402:Gen1 UTSW 12 11242362 missense possibly damaging 0.71
R4572:Gen1 UTSW 12 11242418 missense probably damaging 0.99
R4900:Gen1 UTSW 12 11241560 missense probably benign 0.00
R5091:Gen1 UTSW 12 11246346 missense probably damaging 0.97
R5952:Gen1 UTSW 12 11260896 missense probably damaging 0.96
R6869:Gen1 UTSW 12 11241441 missense probably benign 0.02
R7057:Gen1 UTSW 12 11242418 missense probably benign 0.21
R7155:Gen1 UTSW 12 11241832 missense probably benign 0.25
R7260:Gen1 UTSW 12 11256848 missense probably damaging 0.99
R7316:Gen1 UTSW 12 11241469 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGACACCAAGACTTGCC -3'
(R):5'- TCCACTGTGAACTGTATAGCCATAC -3'

Sequencing Primer
(F):5'- TTGCCACACAATGACTCATCTC -3'
(R):5'- TAGTTCTAGGACAGCCAGTGC -3'
Posted On2018-08-29