Incidental Mutation 'R6794:Agxt'
ID531650
Institutional Source Beutler Lab
Gene Symbol Agxt
Ensembl Gene ENSMUSG00000026272
Gene Namealanine-glyoxylate aminotransferase
SynonymsAgxt1, Agt1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6794 (G1)
Quality Score190.009
Status Not validated
Chromosome1
Chromosomal Location93135240-93145421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93135382 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 30 (V30A)
Ref Sequence ENSEMBL: ENSMUSP00000027491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027491]
PDB Structure
Crystal structure of Putative aminotransferase (AAH25799.1) from MUS MUSCULUS at 1.65 A resolution [X-RAY DIFFRACTION]
Crystal structure of Putative aminotransferase (AAH25799.1) from MUS MUSCULUS at 1.80 A resolution [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027491
AA Change: V30A

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027491
Gene: ENSMUSG00000026272
AA Change: V30A

DomainStartEndE-ValueType
Pfam:Aminotran_5 45 398 3.3e-64 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed only in the liver and the encoded protein is localized mostly in the peroxisomes, where it is involved in glyoxylate detoxification. Mutations in this gene, some of which alter subcellular targetting, have been associated with type I primary hyperoxaluria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urinary oxalate levels and male mice suffer from bladder stones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,637,855 probably null Het
Atf7 T C 15: 102,557,465 K87E probably benign Het
Btg4 A C 9: 51,119,351 K250N possibly damaging Het
Cyc1 A G 15: 76,344,650 Y132C probably damaging Het
Dcaf5 A T 12: 80,398,893 D137E possibly damaging Het
Ddr2 C A 1: 169,982,098 W770L probably damaging Het
Disc1 T C 8: 125,087,775 V126A probably benign Het
Dock8 A G 19: 25,122,441 N643D probably benign Het
Gabrg1 C T 5: 70,815,971 R75H probably damaging Het
Gm14418 A T 2: 177,387,838 H121Q probably damaging Het
H2-Ob T A 17: 34,241,188 L20Q possibly damaging Het
Ica1 T C 6: 8,653,659 D326G probably benign Het
Jph3 T C 8: 121,785,385 L704P probably benign Het
Kmt2e CCTGCTGC CCTGCTGCTGC 5: 23,499,471 probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Kmt2e GCC GCCCCC 5: 23,499,480 probably benign Het
Lnpep T G 17: 17,531,159 N948T probably damaging Het
Mdn1 T A 4: 32,741,893 V3888D probably damaging Het
Muc5ac T C 7: 141,809,552 probably benign Het
Nfkb2 T C 19: 46,307,720 probably null Het
Pik3r2 T C 8: 70,770,717 H380R probably benign Het
Prim1 T C 10: 128,018,149 S124P probably damaging Het
Prokr1 T C 6: 87,588,693 T57A possibly damaging Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Sapcd2 A G 2: 25,376,367 S389G probably damaging Het
Scn5a T C 9: 119,535,889 Q421R probably damaging Het
Serac1 A G 17: 6,051,710 Y430H probably damaging Het
Shf A G 2: 122,353,840 L234P probably damaging Het
Slc22a29 G T 19: 8,161,523 S525Y probably benign Het
Thbs1 A G 2: 118,120,038 probably null Het
Tln2 T C 9: 67,286,558 D666G probably benign Het
Ubqlnl C T 7: 104,148,785 E502K probably benign Het
Uhrf1bp1l T C 10: 89,805,762 S932P probably benign Het
Vmn2r118 T A 17: 55,592,348 H852L possibly damaging Het
Vmn2r72 A G 7: 85,737,996 F787L probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Ylpm1 A G 12: 84,996,881 H131R unknown Het
Other mutations in Agxt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02375:Agxt APN 1 93135703 missense probably damaging 1.00
IGL02938:Agxt APN 1 93145109 missense probably damaging 1.00
R1004:Agxt UTSW 1 93135699 missense possibly damaging 0.94
R1511:Agxt UTSW 1 93135768 missense probably damaging 1.00
R1539:Agxt UTSW 1 93137979 missense probably damaging 0.98
R2049:Agxt UTSW 1 93137315 missense probably benign
R2407:Agxt UTSW 1 93135780 missense probably benign 0.25
R4910:Agxt UTSW 1 93135714 missense probably benign 0.01
R5013:Agxt UTSW 1 93142057 splice site probably benign
R5098:Agxt UTSW 1 93137307 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGACAGAAGGACAAACATTGATC -3'
(R):5'- AGGTCAGATCTGCCTGCTAC -3'

Sequencing Primer
(F):5'- CAAACATTGATCAGGGTTAAATTGAC -3'
(R):5'- GAGTGATCACCACCCCTAGATGG -3'
Posted On2018-08-29