Incidental Mutation 'R6794:Prokr1'
ID531663
Institutional Source Beutler Lab
Gene Symbol Prokr1
Ensembl Gene ENSMUSG00000049409
Gene Nameprokineticin receptor 1
SynonymsPkr1, Gpr73, EG-VEGFR1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6794 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location87578591-87590743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87588693 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 57 (T57A)
Ref Sequence ENSEMBL: ENSMUSP00000145476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050887] [ENSMUST00000203636] [ENSMUST00000204682]
Predicted Effect probably benign
Transcript: ENSMUST00000050887
AA Change: T57A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000059034
Gene: ENSMUSG00000049409
AA Change: T57A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 73 360 8.8e-8 PFAM
Pfam:7tm_1 79 342 7.2e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203636
AA Change: T57A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145476
Gene: ENSMUSG00000049409
AA Change: T57A

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204682
AA Change: T57A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000144999
Gene: ENSMUSG00000049409
AA Change: T57A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 73 360 8.8e-8 PFAM
Pfam:7tm_1 79 342 7.2e-47 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein-coupled receptor family. The encoded protein binds to prokineticins (1 and 2), leading to the activation of MAPK and STAT signaling pathways. Prokineticins are protein ligands involved in angiogenesis and inflammation. The encoded protein is expressed in peripheral tissues such as those comprising the circulatory system, lungs, reproductive system, endocrine system and the gastrointestinal system. The protein may be involved in signaling in human fetal ovary during initiation of primordial follicle formation. Sequence variants in this gene may be associated with recurrent miscarriage. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit abnormal nociceptions and hypoalgesia. Mice homozygous for another null allele exhibit decreased capillary density in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,637,855 probably null Het
Agxt T C 1: 93,135,382 V30A possibly damaging Het
Atf7 T C 15: 102,557,465 K87E probably benign Het
Btg4 A C 9: 51,119,351 K250N possibly damaging Het
Cyc1 A G 15: 76,344,650 Y132C probably damaging Het
Dcaf5 A T 12: 80,398,893 D137E possibly damaging Het
Ddr2 C A 1: 169,982,098 W770L probably damaging Het
Disc1 T C 8: 125,087,775 V126A probably benign Het
Dock8 A G 19: 25,122,441 N643D probably benign Het
Gabrg1 C T 5: 70,815,971 R75H probably damaging Het
Gm14418 A T 2: 177,387,838 H121Q probably damaging Het
H2-Ob T A 17: 34,241,188 L20Q possibly damaging Het
Ica1 T C 6: 8,653,659 D326G probably benign Het
Jph3 T C 8: 121,785,385 L704P probably benign Het
Kmt2e CCTGCTGC CCTGCTGCTGC 5: 23,499,471 probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Kmt2e GCC GCCCCC 5: 23,499,480 probably benign Het
Lnpep T G 17: 17,531,159 N948T probably damaging Het
Mdn1 T A 4: 32,741,893 V3888D probably damaging Het
Muc5ac T C 7: 141,809,552 probably benign Het
Nfkb2 T C 19: 46,307,720 probably null Het
Pik3r2 T C 8: 70,770,717 H380R probably benign Het
Prim1 T C 10: 128,018,149 S124P probably damaging Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Sapcd2 A G 2: 25,376,367 S389G probably damaging Het
Scn5a T C 9: 119,535,889 Q421R probably damaging Het
Serac1 A G 17: 6,051,710 Y430H probably damaging Het
Shf A G 2: 122,353,840 L234P probably damaging Het
Slc22a29 G T 19: 8,161,523 S525Y probably benign Het
Thbs1 A G 2: 118,120,038 probably null Het
Tln2 T C 9: 67,286,558 D666G probably benign Het
Ubqlnl C T 7: 104,148,785 E502K probably benign Het
Uhrf1bp1l T C 10: 89,805,762 S932P probably benign Het
Vmn2r118 T A 17: 55,592,348 H852L possibly damaging Het
Vmn2r72 A G 7: 85,737,996 F787L probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Ylpm1 A G 12: 84,996,881 H131R unknown Het
Other mutations in Prokr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Prokr1 APN 6 87588611 missense probably damaging 1.00
IGL00838:Prokr1 APN 6 87588693 missense possibly damaging 0.94
IGL01083:Prokr1 APN 6 87588784 missense probably benign 0.41
IGL02677:Prokr1 APN 6 87588368 splice site probably benign
IGL03344:Prokr1 APN 6 87588500 missense possibly damaging 0.95
R1953:Prokr1 UTSW 6 87588593 missense probably benign 0.18
R2065:Prokr1 UTSW 6 87588713 missense probably damaging 0.98
R3161:Prokr1 UTSW 6 87588431 missense probably damaging 1.00
R4777:Prokr1 UTSW 6 87588860 start codon destroyed probably null 0.98
R4828:Prokr1 UTSW 6 87581242 missense probably benign 0.07
R4890:Prokr1 UTSW 6 87588696 missense probably benign 0.00
R4943:Prokr1 UTSW 6 87581824 missense possibly damaging 0.90
R6134:Prokr1 UTSW 6 87588855 missense possibly damaging 0.54
R6183:Prokr1 UTSW 6 87588852 missense possibly damaging 0.94
R6329:Prokr1 UTSW 6 87581792 missense possibly damaging 0.94
R6922:Prokr1 UTSW 6 87588473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGACATGACCATGCTCC -3'
(R):5'- TAGATGGAGACCACTGTCGG -3'

Sequencing Primer
(F):5'- CATAGTAGTCCATCTCAAAGGGGC -3'
(R):5'- GGGCTCTGGGTGAGAATACCAC -3'
Posted On2018-08-29