Incidental Mutation 'R6794:Ylpm1'
ID531677
Institutional Source Beutler Lab
Gene Symbol Ylpm1
Ensembl Gene ENSMUSG00000021244
Gene NameYLP motif containing 1
SynonymsZAP, A930013E17Rik, Zap3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R6794 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location84996321-85070515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84996881 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 131 (H131R)
Ref Sequence ENSEMBL: ENSMUSP00000128962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021670] [ENSMUST00000101202] [ENSMUST00000168977]
Predicted Effect unknown
Transcript: ENSMUST00000021670
AA Change: H131R
SMART Domains Protein: ENSMUSP00000021670
Gene: ENSMUSG00000021244
AA Change: H131R

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
internal_repeat_1 771 840 4.03e-5 PROSPERO
low complexity region 841 854 N/A INTRINSIC
low complexity region 966 972 N/A INTRINSIC
internal_repeat_1 1062 1124 4.03e-5 PROSPERO
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1326 1338 N/A INTRINSIC
low complexity region 1339 1353 N/A INTRINSIC
low complexity region 1408 1425 N/A INTRINSIC
coiled coil region 1447 1474 N/A INTRINSIC
low complexity region 1494 1517 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1557 N/A INTRINSIC
low complexity region 1598 1630 N/A INTRINSIC
low complexity region 1678 1694 N/A INTRINSIC
low complexity region 1705 1717 N/A INTRINSIC
low complexity region 1720 1736 N/A INTRINSIC
low complexity region 1797 1808 N/A INTRINSIC
Pfam:AAA_33 1829 1990 7.8e-11 PFAM
coiled coil region 1995 2032 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000101202
AA Change: H131R
SMART Domains Protein: ENSMUSP00000098763
Gene: ENSMUSG00000021244
AA Change: H131R

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 206 N/A INTRINSIC
low complexity region 294 335 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
low complexity region 375 388 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 491 607 N/A INTRINSIC
low complexity region 641 649 N/A INTRINSIC
low complexity region 741 764 N/A INTRINSIC
low complexity region 765 779 N/A INTRINSIC
low complexity region 783 804 N/A INTRINSIC
low complexity region 845 877 N/A INTRINSIC
low complexity region 925 941 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 967 983 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
Pfam:AAA_33 1076 1265 4.9e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168977
AA Change: H131R
SMART Domains Protein: ENSMUSP00000128962
Gene: ENSMUSG00000021244
AA Change: H131R

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 788 811 N/A INTRINSIC
low complexity region 812 826 N/A INTRINSIC
low complexity region 830 851 N/A INTRINSIC
low complexity region 892 924 N/A INTRINSIC
low complexity region 972 988 N/A INTRINSIC
low complexity region 999 1011 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:AAA_33 1123 1311 4.5e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,637,855 probably null Het
Agxt T C 1: 93,135,382 V30A possibly damaging Het
Atf7 T C 15: 102,557,465 K87E probably benign Het
Btg4 A C 9: 51,119,351 K250N possibly damaging Het
Cyc1 A G 15: 76,344,650 Y132C probably damaging Het
Dcaf5 A T 12: 80,398,893 D137E possibly damaging Het
Ddr2 C A 1: 169,982,098 W770L probably damaging Het
Disc1 T C 8: 125,087,775 V126A probably benign Het
Dock8 A G 19: 25,122,441 N643D probably benign Het
Gabrg1 C T 5: 70,815,971 R75H probably damaging Het
Gm14418 A T 2: 177,387,838 H121Q probably damaging Het
H2-Ob T A 17: 34,241,188 L20Q possibly damaging Het
Ica1 T C 6: 8,653,659 D326G probably benign Het
Jph3 T C 8: 121,785,385 L704P probably benign Het
Kmt2e CCTGCTGC CCTGCTGCTGC 5: 23,499,471 probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Kmt2e GCC GCCCCC 5: 23,499,480 probably benign Het
Lnpep T G 17: 17,531,159 N948T probably damaging Het
Mdn1 T A 4: 32,741,893 V3888D probably damaging Het
Muc5ac T C 7: 141,809,552 probably benign Het
Nfkb2 T C 19: 46,307,720 probably null Het
Pik3r2 T C 8: 70,770,717 H380R probably benign Het
Prim1 T C 10: 128,018,149 S124P probably damaging Het
Prokr1 T C 6: 87,588,693 T57A possibly damaging Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Sapcd2 A G 2: 25,376,367 S389G probably damaging Het
Scn5a T C 9: 119,535,889 Q421R probably damaging Het
Serac1 A G 17: 6,051,710 Y430H probably damaging Het
Shf A G 2: 122,353,840 L234P probably damaging Het
Slc22a29 G T 19: 8,161,523 S525Y probably benign Het
Thbs1 A G 2: 118,120,038 probably null Het
Tln2 T C 9: 67,286,558 D666G probably benign Het
Ubqlnl C T 7: 104,148,785 E502K probably benign Het
Uhrf1bp1l T C 10: 89,805,762 S932P probably benign Het
Vmn2r118 T A 17: 55,592,348 H852L possibly damaging Het
Vmn2r72 A G 7: 85,737,996 F787L probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Other mutations in Ylpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ylpm1 APN 12 85028954 missense possibly damaging 0.93
IGL00809:Ylpm1 APN 12 85049194 missense probably damaging 0.99
IGL01508:Ylpm1 APN 12 85015455 missense possibly damaging 0.74
IGL02199:Ylpm1 APN 12 85034005 nonsense probably null
IGL02392:Ylpm1 APN 12 85014957 missense unknown
IGL02455:Ylpm1 APN 12 85030263 missense probably damaging 1.00
IGL02506:Ylpm1 APN 12 85049191 missense probably damaging 1.00
IGL03102:Ylpm1 APN 12 85049258 splice site probably benign
I1329:Ylpm1 UTSW 12 85040880 missense probably damaging 1.00
IGL02799:Ylpm1 UTSW 12 85044484 missense probably damaging 1.00
R0010:Ylpm1 UTSW 12 85029026 missense probably damaging 0.97
R0090:Ylpm1 UTSW 12 85029040 intron probably benign
R0149:Ylpm1 UTSW 12 85028838 missense probably damaging 0.99
R0226:Ylpm1 UTSW 12 85049737 missense probably benign 0.21
R0375:Ylpm1 UTSW 12 85014980 missense unknown
R0378:Ylpm1 UTSW 12 84997076 intron probably benign
R0507:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R0742:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R1350:Ylpm1 UTSW 12 85014082 unclassified probably benign
R1452:Ylpm1 UTSW 12 85030383 missense possibly damaging 0.94
R1500:Ylpm1 UTSW 12 85014996 missense unknown
R1837:Ylpm1 UTSW 12 85029333 missense possibly damaging 0.92
R1945:Ylpm1 UTSW 12 85015418 missense probably damaging 0.98
R1971:Ylpm1 UTSW 12 85040786 missense probably damaging 1.00
R2211:Ylpm1 UTSW 12 85044378 nonsense probably null
R2213:Ylpm1 UTSW 12 85069718 missense probably benign 0.25
R2269:Ylpm1 UTSW 12 85015050 missense unknown
R2300:Ylpm1 UTSW 12 85060319 splice site probably null
R2439:Ylpm1 UTSW 12 85014117 unclassified probably benign
R2497:Ylpm1 UTSW 12 84996761 missense probably damaging 0.98
R2890:Ylpm1 UTSW 12 85029813 missense probably damaging 0.99
R3111:Ylpm1 UTSW 12 85029371 missense probably damaging 0.98
R3436:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R3437:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R4156:Ylpm1 UTSW 12 85057403 intron probably benign
R4157:Ylpm1 UTSW 12 85057403 intron probably benign
R4959:Ylpm1 UTSW 12 85049945 missense probably damaging 1.00
R5014:Ylpm1 UTSW 12 85014749 missense unknown
R5039:Ylpm1 UTSW 12 85015493 missense probably damaging 0.98
R5039:Ylpm1 UTSW 12 85042239 missense probably damaging 1.00
R5084:Ylpm1 UTSW 12 85029321 missense probably damaging 0.99
R5325:Ylpm1 UTSW 12 85013961 unclassified probably benign
R5378:Ylpm1 UTSW 12 85030255 missense probably damaging 0.99
R5428:Ylpm1 UTSW 12 85030229 missense probably benign 0.04
R5467:Ylpm1 UTSW 12 84996859 missense unknown
R5605:Ylpm1 UTSW 12 85028853 missense probably damaging 1.00
R5614:Ylpm1 UTSW 12 85064944 intron probably benign
R5748:Ylpm1 UTSW 12 85060251 splice site probably null
R5860:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5861:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5881:Ylpm1 UTSW 12 85042125 missense probably damaging 1.00
R5909:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5912:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5915:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R6000:Ylpm1 UTSW 12 84997256 missense unknown
R6004:Ylpm1 UTSW 12 85029084 missense possibly damaging 0.78
R6007:Ylpm1 UTSW 12 85029290 missense probably benign 0.33
R6053:Ylpm1 UTSW 12 84996503 missense possibly damaging 0.72
R6104:Ylpm1 UTSW 12 85029630 missense probably benign 0.00
R6197:Ylpm1 UTSW 12 85042179 missense probably damaging 1.00
R6293:Ylpm1 UTSW 12 85015277 missense unknown
R6297:Ylpm1 UTSW 12 85015277 missense unknown
R6305:Ylpm1 UTSW 12 85030545 missense probably damaging 1.00
R6379:Ylpm1 UTSW 12 85030800 missense probably damaging 1.00
R6465:Ylpm1 UTSW 12 85049802 missense probably damaging 1.00
R6608:Ylpm1 UTSW 12 85015277 missense unknown
R6609:Ylpm1 UTSW 12 85015277 missense unknown
R6737:Ylpm1 UTSW 12 85030846 missense probably damaging 0.98
Z1088:Ylpm1 UTSW 12 85030155 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTCCGAGAGCAACACTTGGC -3'
(R):5'- GGCTGGGAATGGCTCAAATATG -3'

Sequencing Primer
(F):5'- CCAGAAGCAAATGCAGTGC -3'
(R):5'- CTGGGAATGGCTCAAATATGATTGTG -3'
Posted On2018-08-29