Incidental Mutation 'R6794:Cyc1'
ID531678
Institutional Source Beutler Lab
Gene Symbol Cyc1
Ensembl Gene ENSMUSG00000022551
Gene Namecytochrome c-1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R6794 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76343523-76346260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76344650 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 132 (Y132C)
Ref Sequence ENSEMBL: ENSMUSP00000023210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023210] [ENSMUST00000023211] [ENSMUST00000160560] [ENSMUST00000229013] [ENSMUST00000230314] [ENSMUST00000230706] [ENSMUST00000231045]
Predicted Effect probably damaging
Transcript: ENSMUST00000023210
AA Change: Y132C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023210
Gene: ENSMUSG00000022551
AA Change: Y132C

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
Pfam:Cytochrom_C1 96 314 1.5e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023211
SMART Domains Protein: ENSMUSP00000023211
Gene: ENSMUSG00000022552

DomainStartEndE-ValueType
Pfam:Sharpin_PH 13 125 1.2e-44 PFAM
low complexity region 187 202 N/A INTRINSIC
PDB:4DBG|A 203 299 1e-17 PDB
SCOP:d1euvb_ 212 301 2e-5 SMART
Blast:UBQ 218 299 2e-26 BLAST
ZnF_RBZ 343 367 9.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159429
SMART Domains Protein: ENSMUSP00000124755
Gene: ENSMUSG00000022552

DomainStartEndE-ValueType
ZnF_RBZ 46 70 9.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160560
SMART Domains Protein: ENSMUSP00000125382
Gene: ENSMUSG00000022552

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
PDB:4EMO|D 24 62 2e-13 PDB
low complexity region 64 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231045
AA Change: Y73C
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the cytochrome bc1 complex, which plays an important role in the mitochondrial respiratory chain by transferring electrons from the Rieske iron-sulfur protein to cytochrome c. Mutations in this gene may cause mitochondrial complex III deficiency, nuclear type 6. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,637,855 probably null Het
Agxt T C 1: 93,135,382 V30A possibly damaging Het
Atf7 T C 15: 102,557,465 K87E probably benign Het
Btg4 A C 9: 51,119,351 K250N possibly damaging Het
Dcaf5 A T 12: 80,398,893 D137E possibly damaging Het
Ddr2 C A 1: 169,982,098 W770L probably damaging Het
Disc1 T C 8: 125,087,775 V126A probably benign Het
Dock8 A G 19: 25,122,441 N643D probably benign Het
Gabrg1 C T 5: 70,815,971 R75H probably damaging Het
Gm14418 A T 2: 177,387,838 H121Q probably damaging Het
H2-Ob T A 17: 34,241,188 L20Q possibly damaging Het
Ica1 T C 6: 8,653,659 D326G probably benign Het
Jph3 T C 8: 121,785,385 L704P probably benign Het
Kmt2e CCTGCTGC CCTGCTGCTGC 5: 23,499,471 probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Kmt2e GCC GCCCCC 5: 23,499,480 probably benign Het
Lnpep T G 17: 17,531,159 N948T probably damaging Het
Mdn1 T A 4: 32,741,893 V3888D probably damaging Het
Muc5ac T C 7: 141,809,552 probably benign Het
Nfkb2 T C 19: 46,307,720 probably null Het
Pik3r2 T C 8: 70,770,717 H380R probably benign Het
Prim1 T C 10: 128,018,149 S124P probably damaging Het
Prokr1 T C 6: 87,588,693 T57A possibly damaging Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Sapcd2 A G 2: 25,376,367 S389G probably damaging Het
Scn5a T C 9: 119,535,889 Q421R probably damaging Het
Serac1 A G 17: 6,051,710 Y430H probably damaging Het
Shf A G 2: 122,353,840 L234P probably damaging Het
Slc22a29 G T 19: 8,161,523 S525Y probably benign Het
Thbs1 A G 2: 118,120,038 probably null Het
Tln2 T C 9: 67,286,558 D666G probably benign Het
Ubqlnl C T 7: 104,148,785 E502K probably benign Het
Uhrf1bp1l T C 10: 89,805,762 S932P probably benign Het
Vmn2r118 T A 17: 55,592,348 H852L possibly damaging Het
Vmn2r72 A G 7: 85,737,996 F787L probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Ylpm1 A G 12: 84,996,881 H131R unknown Het
Other mutations in Cyc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Cyc1 APN 15 76345165 missense probably benign 0.39
IGL01377:Cyc1 APN 15 76344962 nonsense probably null
IGL03111:Cyc1 APN 15 76344872 missense probably benign 0.01
R0131:Cyc1 UTSW 15 76344959 missense probably benign 0.01
R0967:Cyc1 UTSW 15 76345648 unclassified probably benign
R1428:Cyc1 UTSW 15 76344348 missense probably benign 0.00
R2357:Cyc1 UTSW 15 76345566 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAGCTACCCATGGTCTCATC -3'
(R):5'- CATCTCCCCATCATCATTAGGG -3'

Sequencing Primer
(F):5'- ACCCATGGTCTCATCGTGGC -3'
(R):5'- CCCATCATCATTAGGGCCATC -3'
Posted On2018-08-29