Incidental Mutation 'R6794:H2-Ob'
ID531682
Institutional Source Beutler Lab
Gene Symbol H2-Ob
Ensembl Gene ENSMUSG00000041538
Gene Namehistocompatibility 2, O region beta locus
SynonymsOb, H-2Ob, H2-Ab, A-beta2, A-beta-2, H-2I, H2-IAb2, H2-Ab2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6794 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34238903-34245907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34241188 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 20 (L20Q)
Ref Sequence ENSEMBL: ENSMUSP00000133906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095342] [ENSMUST00000167280] [ENSMUST00000173764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095342
AA Change: L91Q

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092985
Gene: ENSMUSG00000041538
AA Change: L91Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
MHC_II_beta 39 113 8.17e-34 SMART
IGc1 138 209 2.24e-24 SMART
transmembrane domain 225 247 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167280
AA Change: L91Q

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129657
Gene: ENSMUSG00000041538
AA Change: L91Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
MHC_II_beta 39 113 8.17e-34 SMART
IGc1 120 183 4.55e-16 SMART
transmembrane domain 199 221 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173764
AA Change: L20Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133906
Gene: ENSMUSG00000041538
AA Change: L20Q

DomainStartEndE-ValueType
Pfam:MHC_II_beta 1 42 8e-12 PFAM
IGc1 67 138 2.24e-24 SMART
transmembrane domain 154 176 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DOB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DOA) and a beta chain (DOB), both anchored in the membrane. It is located in intracellular vesicles. DO suppresses peptide loading of MHC class II molecules by inhibiting HLA-DM. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,637,855 probably null Het
Agxt T C 1: 93,135,382 V30A possibly damaging Het
Atf7 T C 15: 102,557,465 K87E probably benign Het
Btg4 A C 9: 51,119,351 K250N possibly damaging Het
Cyc1 A G 15: 76,344,650 Y132C probably damaging Het
Dcaf5 A T 12: 80,398,893 D137E possibly damaging Het
Ddr2 C A 1: 169,982,098 W770L probably damaging Het
Disc1 T C 8: 125,087,775 V126A probably benign Het
Dock8 A G 19: 25,122,441 N643D probably benign Het
Gabrg1 C T 5: 70,815,971 R75H probably damaging Het
Gm14418 A T 2: 177,387,838 H121Q probably damaging Het
Ica1 T C 6: 8,653,659 D326G probably benign Het
Jph3 T C 8: 121,785,385 L704P probably benign Het
Kmt2e CCTGCTGC CCTGCTGCTGC 5: 23,499,471 probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Kmt2e GCC GCCCCC 5: 23,499,480 probably benign Het
Lnpep T G 17: 17,531,159 N948T probably damaging Het
Mdn1 T A 4: 32,741,893 V3888D probably damaging Het
Muc5ac T C 7: 141,809,552 probably benign Het
Nfkb2 T C 19: 46,307,720 probably null Het
Pik3r2 T C 8: 70,770,717 H380R probably benign Het
Prim1 T C 10: 128,018,149 S124P probably damaging Het
Prokr1 T C 6: 87,588,693 T57A possibly damaging Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Sapcd2 A G 2: 25,376,367 S389G probably damaging Het
Scn5a T C 9: 119,535,889 Q421R probably damaging Het
Serac1 A G 17: 6,051,710 Y430H probably damaging Het
Shf A G 2: 122,353,840 L234P probably damaging Het
Slc22a29 G T 19: 8,161,523 S525Y probably benign Het
Thbs1 A G 2: 118,120,038 probably null Het
Tln2 T C 9: 67,286,558 D666G probably benign Het
Ubqlnl C T 7: 104,148,785 E502K probably benign Het
Uhrf1bp1l T C 10: 89,805,762 S932P probably benign Het
Vmn2r118 T A 17: 55,592,348 H852L possibly damaging Het
Vmn2r72 A G 7: 85,737,996 F787L probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Ylpm1 A G 12: 84,996,881 H131R unknown Het
Other mutations in H2-Ob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01871:H2-Ob APN 17 34242545 missense probably damaging 1.00
IGL03247:H2-Ob APN 17 34243492 missense probably benign
Deciduous UTSW 17 34243886 critical splice acceptor site probably null
K3955:H2-Ob UTSW 17 34241184 missense probably damaging 1.00
R0466:H2-Ob UTSW 17 34242659 missense probably damaging 0.99
R0791:H2-Ob UTSW 17 34242614 missense probably damaging 1.00
R0792:H2-Ob UTSW 17 34242614 missense probably damaging 1.00
R0812:H2-Ob UTSW 17 34244126 utr 3 prime probably benign
R2145:H2-Ob UTSW 17 34242580 missense probably benign 0.00
R4677:H2-Ob UTSW 17 34242644 missense probably benign 0.01
R4741:H2-Ob UTSW 17 34242571 missense possibly damaging 0.73
R5011:H2-Ob UTSW 17 34241279 critical splice donor site probably null
R5084:H2-Ob UTSW 17 34241128 missense probably damaging 1.00
R5135:H2-Ob UTSW 17 34243516 missense probably benign 0.20
R5497:H2-Ob UTSW 17 34241170 missense probably benign 0.42
R6034:H2-Ob UTSW 17 34241218 missense probably damaging 1.00
R6034:H2-Ob UTSW 17 34241218 missense probably damaging 1.00
R6272:H2-Ob UTSW 17 34242644 missense probably benign 0.01
R6433:H2-Ob UTSW 17 34243886 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTATCTGACTTAGTGTGCCAGG -3'
(R):5'- TAGACAGACAGATAGATGATTGCTG -3'

Sequencing Primer
(F):5'- AGGTGCAGCTGGTTCCTAATCC -3'
(R):5'- AGGTTCTCACAGAGAACCC -3'
Posted On2018-08-29