Incidental Mutation 'R6794:Nfkb2'
ID531686
Institutional Source Beutler Lab
Gene Symbol Nfkb2
Ensembl Gene ENSMUSG00000025225
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
SynonymsNF kappaB2, p52
Accession Numbers

Genbank: NM_019408; MGI: 1099800

Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R6794 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location46304737-46312090 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 46307720 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041391] [ENSMUST00000073116] [ENSMUST00000096029] [ENSMUST00000111881] [ENSMUST00000224556] [ENSMUST00000225323]
Predicted Effect probably benign
Transcript: ENSMUST00000041391
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000073116
SMART Domains Protein: ENSMUSP00000072859
Gene: ENSMUSG00000025225

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096029
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000111881
SMART Domains Protein: ENSMUSP00000107512
Gene: ENSMUSG00000025225

DomainStartEndE-ValueType
Pfam:RHD 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224556
Predicted Effect probably benign
Transcript: ENSMUST00000225323
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The protein encoded by this gene can function as both a transcriptional activator or repressor depending on its dimerization partner. The p100 full-length protein is co-translationally processed into a p52 active form. Chromosomal rearrangements and translocations of this locus have been observed in B cell lymphomas, some of which may result in the formation of fusion proteins. There is a pseudogene for this gene on chromosome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit gastric hyperplasia, enlarged lymph nodes, enhanced cytokine production by activated T cells, absence of Peyer's patches, increased susceptibility to Leishmania major, and early postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(5) Chemically induced(2)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,637,855 probably null Het
Agxt T C 1: 93,135,382 V30A possibly damaging Het
Atf7 T C 15: 102,557,465 K87E probably benign Het
Btg4 A C 9: 51,119,351 K250N possibly damaging Het
Cyc1 A G 15: 76,344,650 Y132C probably damaging Het
Dcaf5 A T 12: 80,398,893 D137E possibly damaging Het
Ddr2 C A 1: 169,982,098 W770L probably damaging Het
Disc1 T C 8: 125,087,775 V126A probably benign Het
Dock8 A G 19: 25,122,441 N643D probably benign Het
Gabrg1 C T 5: 70,815,971 R75H probably damaging Het
Gm14418 A T 2: 177,387,838 H121Q probably damaging Het
H2-Ob T A 17: 34,241,188 L20Q possibly damaging Het
Ica1 T C 6: 8,653,659 D326G probably benign Het
Jph3 T C 8: 121,785,385 L704P probably benign Het
Kmt2e CCTGCTGC CCTGCTGCTGC 5: 23,499,471 probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Kmt2e GCC GCCCCC 5: 23,499,480 probably benign Het
Lnpep T G 17: 17,531,159 N948T probably damaging Het
Mdn1 T A 4: 32,741,893 V3888D probably damaging Het
Muc5ac T C 7: 141,809,552 probably benign Het
Pik3r2 T C 8: 70,770,717 H380R probably benign Het
Prim1 T C 10: 128,018,149 S124P probably damaging Het
Prokr1 T C 6: 87,588,693 T57A possibly damaging Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Sapcd2 A G 2: 25,376,367 S389G probably damaging Het
Scn5a T C 9: 119,535,889 Q421R probably damaging Het
Serac1 A G 17: 6,051,710 Y430H probably damaging Het
Shf A G 2: 122,353,840 L234P probably damaging Het
Slc22a29 G T 19: 8,161,523 S525Y probably benign Het
Thbs1 A G 2: 118,120,038 probably null Het
Tln2 T C 9: 67,286,558 D666G probably benign Het
Ubqlnl C T 7: 104,148,785 E502K probably benign Het
Uhrf1bp1l T C 10: 89,805,762 S932P probably benign Het
Vmn2r118 T A 17: 55,592,348 H852L possibly damaging Het
Vmn2r72 A G 7: 85,737,996 F787L probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Ylpm1 A G 12: 84,996,881 H131R unknown Het
Other mutations in Nfkb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
xander APN 19 splice acceptor site
IGL01466:Nfkb2 APN 19 46308016 missense probably damaging 0.96
IGL01791:Nfkb2 APN 19 46309839 unclassified probably benign
IGL01966:Nfkb2 APN 19 46309690 missense probably benign 0.04
IGL03296:Nfkb2 APN 19 46309928 missense probably damaging 1.00
pale_fire UTSW 19 46311626 missense possibly damaging 0.96
R0270:Nfkb2 UTSW 19 46311626 missense possibly damaging 0.96
R0561:Nfkb2 UTSW 19 46309862 missense possibly damaging 0.93
R1944:Nfkb2 UTSW 19 46308052 missense probably damaging 1.00
R2217:Nfkb2 UTSW 19 46307724 splice site probably null
R2878:Nfkb2 UTSW 19 46307441 missense possibly damaging 0.86
R4493:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4494:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4495:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4731:Nfkb2 UTSW 19 46308964 missense possibly damaging 0.74
R4752:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4753:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4777:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4780:Nfkb2 UTSW 19 46309922 missense probably damaging 1.00
R4820:Nfkb2 UTSW 19 46308054 missense probably damaging 0.99
R4837:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4839:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5514:Nfkb2 UTSW 19 46311408 missense probably damaging 1.00
R5519:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5549:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5615:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5616:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5709:Nfkb2 UTSW 19 46310521 missense probably damaging 1.00
R6053:Nfkb2 UTSW 19 46311812 missense probably damaging 1.00
S24628:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATTGTCCATCCAGAGGCTGAG -3'
(R):5'- CCTGGAGACTCTATAAGGTGGG -3'

Sequencing Primer
(F):5'- CAGAGGCTGAGCGGCGG -3'
(R):5'- CTCGGTGGGGTCATTATCAAAC -3'
Posted On2018-08-29