Incidental Mutation 'R6761:Efcab14'
ID531691
Institutional Source Beutler Lab
Gene Symbol Efcab14
Ensembl Gene ENSMUSG00000034210
Gene NameEF-hand calcium binding domain 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R6761 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location115737744-115777327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115738827 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 57 (S57P)
Ref Sequence ENSEMBL: ENSMUSP00000074025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074425] [ENSMUST00000106522] [ENSMUST00000106524] [ENSMUST00000106525]
Predicted Effect probably damaging
Transcript: ENSMUST00000074425
AA Change: S57P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074025
Gene: ENSMUSG00000034210
AA Change: S57P

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1fi6a_ 425 498 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106522
AA Change: S57P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102132
Gene: ENSMUSG00000034210
AA Change: S57P

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106524
AA Change: S57P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102134
Gene: ENSMUSG00000034210
AA Change: S57P

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1hqva_ 360 418 3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106525
AA Change: S57P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102135
Gene: ENSMUSG00000034210
AA Change: S57P

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1hqva_ 424 482 3e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Actr3b C T 5: 25,825,139 S67F probably damaging Het
Ap3m1 T C 14: 21,038,028 M107V probably benign Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Clec3b G T 9: 123,156,939 G134V probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 I203N possibly damaging Het
Hltf T A 3: 20,083,832 probably null Het
Igkv3-2 G T 6: 70,698,517 probably benign Het
Mslnl A G 17: 25,746,073 D471G probably damaging Het
Msmo1 A G 8: 64,719,027 Y281H probably benign Het
Nid1 A G 13: 13,482,035 T584A probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Prss45 G T 9: 110,840,419 A197S probably damaging Het
Rpap2 T A 5: 107,620,238 I314N probably benign Het
Sash1 A G 10: 8,744,522 M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Uty T C Y: 1,186,790 H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 T140A probably benign Het
Other mutations in Efcab14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02232:Efcab14 APN 4 115760064 splice site probably benign
IGL02300:Efcab14 APN 4 115758896 critical splice donor site probably null
IGL02598:Efcab14 APN 4 115740434 nonsense probably null
IGL02680:Efcab14 APN 4 115740418 missense probably damaging 1.00
IGL03066:Efcab14 APN 4 115738804 missense probably benign 0.12
R0123:Efcab14 UTSW 4 115740531 missense probably damaging 1.00
R0134:Efcab14 UTSW 4 115740531 missense probably damaging 1.00
R1275:Efcab14 UTSW 4 115756473 missense probably damaging 1.00
R1481:Efcab14 UTSW 4 115756517 missense probably benign 0.07
R1590:Efcab14 UTSW 4 115756549 splice site probably benign
R1694:Efcab14 UTSW 4 115746539 missense possibly damaging 0.82
R1768:Efcab14 UTSW 4 115752919 critical splice acceptor site probably null
R1769:Efcab14 UTSW 4 115752991 missense probably damaging 1.00
R3887:Efcab14 UTSW 4 115738660 start codon destroyed probably null 1.00
R4158:Efcab14 UTSW 4 115740397 missense probably damaging 0.99
R4160:Efcab14 UTSW 4 115740397 missense probably damaging 0.99
R5584:Efcab14 UTSW 4 115764597 missense possibly damaging 0.49
R5690:Efcab14 UTSW 4 115760047 missense possibly damaging 0.71
R5796:Efcab14 UTSW 4 115746583 missense probably damaging 0.99
R5945:Efcab14 UTSW 4 115756467 missense probably damaging 1.00
R6445:Efcab14 UTSW 4 115756471 missense possibly damaging 0.74
X0018:Efcab14 UTSW 4 115766486 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGGTGTTGGCTACGAACC -3'
(R):5'- GAACTTGCCCTGTCCAACATCC -3'

Sequencing Primer
(F):5'- TGTTGGCTACGAACCTGGCAG -3'
(R):5'- AACATCCTTTCTCCCTGTTTTCCAAG -3'
Posted On2018-08-29