Incidental Mutation 'R6761:Actr3b'
ID531694
Institutional Source Beutler Lab
Gene Symbol Actr3b
Ensembl Gene ENSMUSG00000056367
Gene NameARP3 actin-related protein 3B
SynonymsARP11, Arp3b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6761 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location25759997-25850688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25825139 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 67 (S67F)
Ref Sequence ENSEMBL: ENSMUSP00000121629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088244] [ENSMUST00000128727]
Predicted Effect probably damaging
Transcript: ENSMUST00000088244
AA Change: S155F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085578
Gene: ENSMUSG00000056367
AA Change: S155F

DomainStartEndE-ValueType
ACTIN 5 413 1.33e-178 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128727
AA Change: S67F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121629
Gene: ENSMUSG00000056367
AA Change: S67F

DomainStartEndE-ValueType
ACTIN 1 325 1.27e-111 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the actin-related proteins (ARP), which form multiprotein complexes and share 35-55% amino acid identity with conventional actin. The protein encoded by this gene may have a regulatory role in the actin cytoskeleton and induce cell-shape change and motility. Pseudogenes of this gene are located on chromosomes 2, 4, 10, 16, 22 and Y. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Ap3m1 T C 14: 21,038,028 M107V probably benign Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Clec3b G T 9: 123,156,939 G134V probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Efcab14 T C 4: 115,738,827 S57P probably damaging Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 I203N possibly damaging Het
Hltf T A 3: 20,083,832 probably null Het
Igkv3-2 G T 6: 70,698,517 probably benign Het
Mslnl A G 17: 25,746,073 D471G probably damaging Het
Msmo1 A G 8: 64,719,027 Y281H probably benign Het
Nid1 A G 13: 13,482,035 T584A probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Prss45 G T 9: 110,840,419 A197S probably damaging Het
Rpap2 T A 5: 107,620,238 I314N probably benign Het
Sash1 A G 10: 8,744,522 M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Uty T C Y: 1,186,790 H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 T140A probably benign Het
Other mutations in Actr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Actr3b APN 5 25849162 splice site probably null
IGL02582:Actr3b APN 5 25832413 missense probably benign 0.11
IGL02869:Actr3b APN 5 25832435 missense probably damaging 1.00
IGL02946:Actr3b APN 5 25848483 missense possibly damaging 0.50
R0443:Actr3b UTSW 5 25848411 missense probably damaging 0.99
R0446:Actr3b UTSW 5 25831732 missense probably damaging 0.98
R0727:Actr3b UTSW 5 25811939 missense possibly damaging 0.89
R1070:Actr3b UTSW 5 25848493 splice site probably benign
R1643:Actr3b UTSW 5 25812011 missense probably damaging 1.00
R1820:Actr3b UTSW 5 25849158 critical splice donor site probably null
R1837:Actr3b UTSW 5 25825159 missense probably benign 0.00
R1899:Actr3b UTSW 5 25829538 missense possibly damaging 0.71
R2041:Actr3b UTSW 5 25760130 critical splice donor site probably null
R2096:Actr3b UTSW 5 25831745 nonsense probably null
R2109:Actr3b UTSW 5 25831711 missense possibly damaging 0.89
R2256:Actr3b UTSW 5 25822405 missense possibly damaging 0.88
R3078:Actr3b UTSW 5 25822442 missense probably damaging 1.00
R5572:Actr3b UTSW 5 25809888 missense probably benign 0.00
R5655:Actr3b UTSW 5 25848368 missense probably damaging 1.00
R6190:Actr3b UTSW 5 25831690 missense probably benign
R7003:Actr3b UTSW 5 25798463 missense probably damaging 1.00
R7043:Actr3b UTSW 5 25849938 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGAAGTGAAAACTGGCACGC -3'
(R):5'- CATGTTACTTGAGTAGGCTGCG -3'

Sequencing Primer
(F):5'- AACTGGCACGCAGGTTG -3'
(R):5'- AGGCTGCGTTTTAATTTGCC -3'
Posted On2018-08-29