Incidental Mutation 'R6761:Igkv3-2'
ID531700
Institutional Source Beutler Lab
Gene Symbol Igkv3-2
Ensembl Gene ENSMUSG00000095351
Gene Nameimmunoglobulin kappa variable 3-2
SynonymsV(kappa)21A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R6761 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location70698468-70699067 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) G to T at 70698517 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103403]
Predicted Effect probably benign
Transcript: ENSMUST00000103403
SMART Domains Protein: ENSMUSP00000100204
Gene: ENSMUSG00000095351

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGv 38 114 5.39e-18 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Actr3b C T 5: 25,825,139 S67F probably damaging Het
Ap3m1 T C 14: 21,038,028 M107V probably benign Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Clec3b G T 9: 123,156,939 G134V probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Efcab14 T C 4: 115,738,827 S57P probably damaging Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 I203N possibly damaging Het
Hltf T A 3: 20,083,832 probably null Het
Mslnl A G 17: 25,746,073 D471G probably damaging Het
Msmo1 A G 8: 64,719,027 Y281H probably benign Het
Nid1 A G 13: 13,482,035 T584A probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Prss45 G T 9: 110,840,419 A197S probably damaging Het
Rpap2 T A 5: 107,620,238 I314N probably benign Het
Sash1 A G 10: 8,744,522 M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Uty T C Y: 1,186,790 H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 T140A probably benign Het
Other mutations in Igkv3-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Igkv3-2 APN 6 70698994 missense probably damaging 0.98
IGL02352:Igkv3-2 APN 6 70698490 missense probably damaging 0.96
IGL02359:Igkv3-2 APN 6 70698490 missense probably damaging 0.96
IGL02627:Igkv3-2 APN 6 70698826 missense probably damaging 1.00
R3714:Igkv3-2 UTSW 6 70698496 missense possibly damaging 0.66
R4255:Igkv3-2 UTSW 6 70699061 missense probably benign 0.00
R4449:Igkv3-2 UTSW 6 70698841 missense probably benign 0.11
R4663:Igkv3-2 UTSW 6 70698879 missense probably benign 0.02
R5361:Igkv3-2 UTSW 6 70699027 missense probably benign 0.01
R6347:Igkv3-2 UTSW 6 70699033 missense probably benign 0.01
R6466:Igkv3-2 UTSW 6 70699039 missense probably benign 0.15
R6874:Igkv3-2 UTSW 6 70698838 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGACAGCAACTCCCTGTG -3'
(R):5'- CCCAGCAGAGGACCTTTTAG -3'

Sequencing Primer
(F):5'- AACTCCCTGTGGGTGAAAC -3'
(R):5'- CAGGGGACTGAGGAATCT -3'
Posted On2018-08-29