Incidental Mutation 'R6761:Msmo1'
ID531705
Institutional Source Beutler Lab
Gene Symbol Msmo1
Ensembl Gene ENSMUSG00000031604
Gene Namemethylsterol monoxygenase 1
SynonymsDESP4, 1500001G16Rik, Sc4mol, ERG25, C78600
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R6761 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location64718139-64733792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64719027 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 281 (Y281H)
Ref Sequence ENSEMBL: ENSMUSP00000034015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034015] [ENSMUST00000147419]
Predicted Effect probably benign
Transcript: ENSMUST00000034015
AA Change: Y281H

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034015
Gene: ENSMUSG00000031604
AA Change: Y281H

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
Pfam:FA_hydroxylase 142 274 2.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147419
SMART Domains Protein: ENSMUSP00000117545
Gene: ENSMUSG00000031604

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sterol-C4-mehtyl oxidase-like protein was isolated based on its similarity to the yeast ERG25 protein. It contains a set of putative metal binding motifs with similarity to that seen in a family of membrane desaturases-hydroxylases. The protein is localized to the endoplasmic reticulum membrane and is believed to function in cholesterol biosynthesis. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Actr3b C T 5: 25,825,139 S67F probably damaging Het
Ap3m1 T C 14: 21,038,028 M107V probably benign Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Clec3b G T 9: 123,156,939 G134V probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Efcab14 T C 4: 115,738,827 S57P probably damaging Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 I203N possibly damaging Het
Hltf T A 3: 20,083,832 probably null Het
Igkv3-2 G T 6: 70,698,517 probably benign Het
Mslnl A G 17: 25,746,073 D471G probably damaging Het
Nid1 A G 13: 13,482,035 T584A probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Prss45 G T 9: 110,840,419 A197S probably damaging Het
Rpap2 T A 5: 107,620,238 I314N probably benign Het
Sash1 A G 10: 8,744,522 M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Uty T C Y: 1,186,790 H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 T140A probably benign Het
Other mutations in Msmo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Msmo1 APN 8 64727872 missense probably benign 0.00
R0892:Msmo1 UTSW 8 64722553 missense possibly damaging 0.67
R1383:Msmo1 UTSW 8 64723645 missense probably benign 0.00
R1432:Msmo1 UTSW 8 64727616 splice site probably benign
R1604:Msmo1 UTSW 8 64727655 missense probably damaging 0.99
R3872:Msmo1 UTSW 8 64722463 critical splice donor site probably null
R4520:Msmo1 UTSW 8 64720523 unclassified probably benign
R4654:Msmo1 UTSW 8 64727854 missense probably benign 0.02
R5501:Msmo1 UTSW 8 64722489 missense probably damaging 1.00
R5828:Msmo1 UTSW 8 64719110 missense probably damaging 1.00
R6196:Msmo1 UTSW 8 64727884 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTCCCACATATACAGATCTTGGAC -3'
(R):5'- CCATTTGTTCAGCATGTGTCTG -3'

Sequencing Primer
(F):5'- CGTAAGGTAGAAGAGCTCTCATCTG -3'
(R):5'- CAGCATGTGTCTGGTGAATAAC -3'
Posted On2018-08-29