Incidental Mutation 'R6761:Prss45'
ID531707
Institutional Source Beutler Lab
Gene Symbol Prss45
Ensembl Gene ENSMUSG00000047257
Gene Nameprotease, serine 45
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.035) question?
Stock #R6761 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110834588-110841313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110840419 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 197 (A197S)
Ref Sequence ENSEMBL: ENSMUSP00000011391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011391] [ENSMUST00000146794] [ENSMUST00000176403]
Predicted Effect probably damaging
Transcript: ENSMUST00000011391
AA Change: A197S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000011391
Gene: ENSMUSG00000047257
AA Change: A197S

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Tryp_SPc 44 286 6.39e-50 SMART
low complexity region 302 317 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146794
AA Change: A188S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120471
Gene: ENSMUSG00000047257
AA Change: A188S

DomainStartEndE-ValueType
Tryp_SPc 35 277 3.19e-50 SMART
low complexity region 293 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176403
SMART Domains Protein: ENSMUSP00000135787
Gene: ENSMUSG00000049719

DomainStartEndE-ValueType
Tryp_SPc 43 276 1.62e-60 SMART
transmembrane domain 291 313 N/A INTRINSIC
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Actr3b C T 5: 25,825,139 S67F probably damaging Het
Ap3m1 T C 14: 21,038,028 M107V probably benign Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Clec3b G T 9: 123,156,939 G134V probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Efcab14 T C 4: 115,738,827 S57P probably damaging Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 I203N possibly damaging Het
Hltf T A 3: 20,083,832 probably null Het
Igkv3-2 G T 6: 70,698,517 probably benign Het
Mslnl A G 17: 25,746,073 D471G probably damaging Het
Msmo1 A G 8: 64,719,027 Y281H probably benign Het
Nid1 A G 13: 13,482,035 T584A probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Rpap2 T A 5: 107,620,238 I314N probably benign Het
Sash1 A G 10: 8,744,522 M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Uty T C Y: 1,186,790 H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 T140A probably benign Het
Other mutations in Prss45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Prss45 APN 9 110841005 missense probably damaging 1.00
IGL00561:Prss45 APN 9 110840510 missense probably damaging 1.00
IGL03392:Prss45 APN 9 110840550 nonsense probably null
PIT4260001:Prss45 UTSW 9 110838445 missense probably benign 0.00
R0025:Prss45 UTSW 9 110840894 missense probably damaging 0.99
R0576:Prss45 UTSW 9 110838429 missense probably benign
R1464:Prss45 UTSW 9 110840951 missense possibly damaging 0.56
R1464:Prss45 UTSW 9 110840951 missense possibly damaging 0.56
R1572:Prss45 UTSW 9 110838429 missense probably benign 0.00
R2420:Prss45 UTSW 9 110839092 missense possibly damaging 0.48
R4289:Prss45 UTSW 9 110840929 missense probably benign 0.01
R5049:Prss45 UTSW 9 110840470 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGAACCAAGCAAGGCCTTG -3'
(R):5'- TGGATTGCAGCCAGTACAGTC -3'

Sequencing Primer
(F):5'- TTGCTGTGTCCGCCAGC -3'
(R):5'- TTGCAGCCAGTACAGTCATAAAG -3'
Posted On2018-08-29