Incidental Mutation 'R6761:Clec3b'
ID531708
Institutional Source Beutler Lab
Gene Symbol Clec3b
Ensembl Gene ENSMUSG00000025784
Gene NameC-type lectin domain family 3, member b
SynonymsTna
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6761 (G1)
Quality Score202.009
Status Validated
Chromosome9
Chromosomal Location123150946-123157432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 123156939 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 134 (G134V)
Ref Sequence ENSEMBL: ENSMUSP00000026890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026890]
Predicted Effect probably damaging
Transcript: ENSMUST00000026890
AA Change: G134V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026890
Gene: ENSMUSG00000025784
AA Change: G134V

DomainStartEndE-ValueType
low complexity region 27 36 N/A INTRINSIC
CLECT 71 198 1.02e-25 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele develop pronounced cervical lordosis and thoracic kyphosis associated with wedge-shaped deformities of the vertebrae, growth plate irregularities, and an asymmetric development of the intervertebral disks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Actr3b C T 5: 25,825,139 S67F probably damaging Het
Ap3m1 T C 14: 21,038,028 M107V probably benign Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Efcab14 T C 4: 115,738,827 S57P probably damaging Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 I203N possibly damaging Het
Hltf T A 3: 20,083,832 probably null Het
Igkv3-2 G T 6: 70,698,517 probably benign Het
Mslnl A G 17: 25,746,073 D471G probably damaging Het
Msmo1 A G 8: 64,719,027 Y281H probably benign Het
Nid1 A G 13: 13,482,035 T584A probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Prss45 G T 9: 110,840,419 A197S probably damaging Het
Rpap2 T A 5: 107,620,238 I314N probably benign Het
Sash1 A G 10: 8,744,522 M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Uty T C Y: 1,186,790 H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 T140A probably benign Het
Other mutations in Clec3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02441:Clec3b APN 9 123151113 missense possibly damaging 0.61
IGL02884:Clec3b APN 9 123156762 missense probably benign 0.00
IGL03092:Clec3b APN 9 123151035 start gained probably benign
R0025:Clec3b UTSW 9 123157025 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTTCTGTGACAGCCATC -3'
(R):5'- TGGCAGATGTAGGGCAACTG -3'

Sequencing Primer
(F):5'- GACAGCCATCTCTCCCTTCAGTG -3'
(R):5'- TGTAGGGCAACTGATCGC -3'
Posted On2018-08-29