Incidental Mutation 'R6761:Hkdc1'
ID531710
Institutional Source Beutler Lab
Gene Symbol Hkdc1
Ensembl Gene ENSMUSG00000020080
Gene Namehexokinase domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R6761 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location62383137-62422491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62408698 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 203 (I203N)
Ref Sequence ENSEMBL: ENSMUSP00000020277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020277]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020277
AA Change: I203N

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020277
Gene: ENSMUSG00000020080
AA Change: I203N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 3.3e-71 PFAM
Pfam:Hexokinase_2 225 459 5.6e-79 PFAM
Pfam:Hexokinase_1 469 665 9.5e-76 PFAM
Pfam:Hexokinase_2 670 904 5.1e-84 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hexokinase protein family. The encoded protein is involved in glucose metabolism, and reduced expression may be associated with gestational diabetes mellitus. High expression of this gene may also be associated with poor prognosis in hepatocarcinoma. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to genotyping. Mice heterozygous for a knock-out allele exhibit impaired glucose tolerance and female-specific increased in hepatic triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Actr3b C T 5: 25,825,139 S67F probably damaging Het
Ap3m1 T C 14: 21,038,028 M107V probably benign Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Clec3b G T 9: 123,156,939 G134V probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Efcab14 T C 4: 115,738,827 S57P probably damaging Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hltf T A 3: 20,083,832 probably null Het
Igkv3-2 G T 6: 70,698,517 probably benign Het
Mslnl A G 17: 25,746,073 D471G probably damaging Het
Msmo1 A G 8: 64,719,027 Y281H probably benign Het
Nid1 A G 13: 13,482,035 T584A probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Prss45 G T 9: 110,840,419 A197S probably damaging Het
Rpap2 T A 5: 107,620,238 I314N probably benign Het
Sash1 A G 10: 8,744,522 M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Uty T C Y: 1,186,790 H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 T140A probably benign Het
Other mutations in Hkdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Hkdc1 APN 10 62393789 missense probably damaging 0.99
IGL01300:Hkdc1 APN 10 62395261 splice site probably benign
IGL01415:Hkdc1 APN 10 62393859 missense probably damaging 1.00
IGL01935:Hkdc1 APN 10 62400386 missense probably damaging 0.97
IGL02903:Hkdc1 APN 10 62400191 critical splice donor site probably null
IGL03100:Hkdc1 APN 10 62417829 missense probably benign 0.00
IGL03154:Hkdc1 APN 10 62385705 missense probably damaging 1.00
R0368:Hkdc1 UTSW 10 62411707 missense probably null 0.04
R0549:Hkdc1 UTSW 10 62400240 missense probably benign
R0667:Hkdc1 UTSW 10 62411865 splice site probably benign
R0751:Hkdc1 UTSW 10 62398673 missense probably damaging 0.99
R1779:Hkdc1 UTSW 10 62391383 missense probably damaging 1.00
R1929:Hkdc1 UTSW 10 62417898 missense probably benign 0.01
R2271:Hkdc1 UTSW 10 62417898 missense probably benign 0.01
R3831:Hkdc1 UTSW 10 62400212 missense probably benign
R4480:Hkdc1 UTSW 10 62391372 missense probably benign
R4561:Hkdc1 UTSW 10 62409839 missense probably benign 0.00
R4576:Hkdc1 UTSW 10 62385843 missense possibly damaging 0.56
R4655:Hkdc1 UTSW 10 62400463 missense probably benign 0.09
R4723:Hkdc1 UTSW 10 62400354 missense probably benign 0.00
R4810:Hkdc1 UTSW 10 62411525 missense probably benign 0.08
R5086:Hkdc1 UTSW 10 62395274 intron probably benign
R5138:Hkdc1 UTSW 10 62398691 missense probably damaging 1.00
R5781:Hkdc1 UTSW 10 62417933 missense probably damaging 0.98
R5900:Hkdc1 UTSW 10 62408666 missense possibly damaging 0.91
R5982:Hkdc1 UTSW 10 62393810 missense probably benign
R6418:Hkdc1 UTSW 10 62383804 missense possibly damaging 0.93
R6463:Hkdc1 UTSW 10 62393702 missense probably damaging 1.00
R6612:Hkdc1 UTSW 10 62395441 missense possibly damaging 0.48
R6673:Hkdc1 UTSW 10 62403606 missense probably damaging 0.99
R6915:Hkdc1 UTSW 10 62401932 missense possibly damaging 0.92
R7114:Hkdc1 UTSW 10 62393843 missense not run
Predicted Primers PCR Primer
(F):5'- ATAGATGCAGGCTTCGCATC -3'
(R):5'- ACAGCAGTCATTCCCTCAGC -3'

Sequencing Primer
(F):5'- CCGTGTTGCTCTGCAGAAAAATG -3'
(R):5'- GTCATTCCCTCAGCGCAGAAG -3'
Posted On2018-08-29