Incidental Mutation 'R6761:Nid1'
ID531713
Institutional Source Beutler Lab
Gene Symbol Nid1
Ensembl Gene ENSMUSG00000005397
Gene Namenidogen 1
Synonymsentactin 1, nidogen-1, entactin, entactin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R6761 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location13437551-13512269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13482035 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 584 (T584A)
Ref Sequence ENSEMBL: ENSMUSP00000005532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005532]
PDB Structure
NIDOGEN-1 G2/PERLECAN IG3 COMPLEX [X-RAY DIFFRACTION]
DOMAIN G2 OF MOUSE NIDOGEN-1 [X-RAY DIFFRACTION]
Crystal structure of Nidogen/Laminin Complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005532
AA Change: T584A

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000005532
Gene: ENSMUSG00000005397
AA Change: T584A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
NIDO 106 270 3.8e-70 SMART
low complexity region 277 296 N/A INTRINSIC
EGF 387 424 3.46e0 SMART
G2F 425 664 7.69e-153 SMART
EGF 669 707 8.65e-1 SMART
EGF_CA 708 749 4.38e-11 SMART
EGF 759 799 8.19e-2 SMART
EGF_CA 800 838 1.42e-10 SMART
TY 873 921 1.17e-19 SMART
LY 968 1010 1.35e-2 SMART
LY 1011 1053 4.34e-15 SMART
LY 1054 1098 3.34e-16 SMART
LY 1099 1141 3.25e-5 SMART
LY 1142 1181 1.08e1 SMART
EGF 1209 1242 2.45e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane glycoproteins. The protein interacts with several other components of basement membranes, and may play a role in cell interactions with the extracellular matrix. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurologic deficits including seizure-like symptoms and loss of muscle control in the hind legs, and show altered basement membrane morphology in selected locations including brain capillaries and the lens capsule. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Actr3b C T 5: 25,825,139 S67F probably damaging Het
Ap3m1 T C 14: 21,038,028 M107V probably benign Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Clec3b G T 9: 123,156,939 G134V probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Efcab14 T C 4: 115,738,827 S57P probably damaging Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 I203N possibly damaging Het
Hltf T A 3: 20,083,832 probably null Het
Igkv3-2 G T 6: 70,698,517 probably benign Het
Mslnl A G 17: 25,746,073 D471G probably damaging Het
Msmo1 A G 8: 64,719,027 Y281H probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Prss45 G T 9: 110,840,419 A197S probably damaging Het
Rpap2 T A 5: 107,620,238 I314N probably benign Het
Sash1 A G 10: 8,744,522 M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Uty T C Y: 1,186,790 H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 T140A probably benign Het
Other mutations in Nid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Nid1 APN 13 13476392 missense probably damaging 1.00
IGL02126:Nid1 APN 13 13489158 splice site probably null
IGL02452:Nid1 APN 13 13508720 missense probably benign 0.17
IGL02806:Nid1 APN 13 13468312 missense probably benign 0.00
IGL02966:Nid1 APN 13 13482221 missense probably benign 0.09
IGL03136:Nid1 APN 13 13500499 missense probably benign 0.33
IGL03411:Nid1 APN 13 13437889 missense probably damaging 0.98
R0384:Nid1 UTSW 13 13463836 missense probably benign 0.34
R0413:Nid1 UTSW 13 13482096 missense probably benign 0.01
R1257:Nid1 UTSW 13 13483790 missense probably benign 0.01
R1390:Nid1 UTSW 13 13476246 missense probably damaging 1.00
R1397:Nid1 UTSW 13 13508795 missense possibly damaging 0.94
R2057:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2058:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2059:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2132:Nid1 UTSW 13 13509486 missense probably benign 0.04
R2140:Nid1 UTSW 13 13499668 missense probably damaging 1.00
R2195:Nid1 UTSW 13 13476203 missense probably damaging 1.00
R2237:Nid1 UTSW 13 13500485 missense probably benign
R2312:Nid1 UTSW 13 13500493 missense probably benign 0.15
R2987:Nid1 UTSW 13 13499673 missense probably benign 0.40
R3696:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3697:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3698:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3772:Nid1 UTSW 13 13476418 splice site probably benign
R4092:Nid1 UTSW 13 13486639 missense probably damaging 0.96
R4126:Nid1 UTSW 13 13476372 missense probably damaging 1.00
R4128:Nid1 UTSW 13 13476372 missense probably damaging 1.00
R4680:Nid1 UTSW 13 13472852 missense probably damaging 1.00
R4717:Nid1 UTSW 13 13506501 missense probably benign 0.00
R4783:Nid1 UTSW 13 13499741 missense probably damaging 0.97
R4812:Nid1 UTSW 13 13506468 nonsense probably null
R4834:Nid1 UTSW 13 13508823 missense probably damaging 1.00
R4915:Nid1 UTSW 13 13499586 missense possibly damaging 0.89
R4930:Nid1 UTSW 13 13510011 missense probably damaging 1.00
R5101:Nid1 UTSW 13 13483754 missense probably damaging 1.00
R5276:Nid1 UTSW 13 13468572 missense probably damaging 0.99
R5427:Nid1 UTSW 13 13483683 missense probably damaging 1.00
R5447:Nid1 UTSW 13 13437910 missense probably benign 0.00
R5507:Nid1 UTSW 13 13489037 nonsense probably null
R5663:Nid1 UTSW 13 13472834 missense probably damaging 1.00
R5868:Nid1 UTSW 13 13489157 critical splice donor site probably null
R6313:Nid1 UTSW 13 13463782 missense probably benign 0.01
R7069:Nid1 UTSW 13 13508768 missense probably benign
X0028:Nid1 UTSW 13 13509534 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATCCCTGATGCTGCTACAGG -3'
(R):5'- ATAGCGCAAGATCCTCTCCTCC -3'

Sequencing Primer
(F):5'- CCTGATGCTGCTACAGGAGAGG -3'
(R):5'- AAGATCCTCTCCTCCTTGTTGTACAG -3'
Posted On2018-08-29