Incidental Mutation 'R6761:Mslnl'
ID531717
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Namemesothelin-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6761 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25736040-25748330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25746073 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 471 (D471G)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098] [ENSMUST00000075884]
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: D471G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: D471G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075884
SMART Domains Protein: ENSMUSP00000075279
Gene: ENSMUSG00000063011

DomainStartEndE-ValueType
Pfam:Mesothelin 1 624 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Actr3b C T 5: 25,825,139 S67F probably damaging Het
Ap3m1 T C 14: 21,038,028 M107V probably benign Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Clec3b G T 9: 123,156,939 G134V probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Efcab14 T C 4: 115,738,827 S57P probably damaging Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 I203N possibly damaging Het
Hltf T A 3: 20,083,832 probably null Het
Igkv3-2 G T 6: 70,698,517 probably benign Het
Msmo1 A G 8: 64,719,027 Y281H probably benign Het
Nid1 A G 13: 13,482,035 T584A probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Prss45 G T 9: 110,840,419 A197S probably damaging Het
Rpap2 T A 5: 107,620,238 I314N probably benign Het
Sash1 A G 10: 8,744,522 M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Uty T C Y: 1,186,790 H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 T140A probably benign Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25743667 unclassified probably benign
IGL01629:Mslnl APN 17 25744775 missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25746151 missense probably benign 0.07
IGL02408:Mslnl APN 17 25747998 missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25744103 critical splice donor site probably null
IGL03387:Mslnl APN 17 25744077 missense probably benign 0.06
R0561:Mslnl UTSW 17 25743203 nonsense probably null
R0881:Mslnl UTSW 17 25742965 missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1296:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1582:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1629:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1630:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1631:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1632:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1794:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1850:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1866:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1876:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1914:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2166:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2241:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2243:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2247:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2282:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2284:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2852:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2877:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2878:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2919:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2920:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3026:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3405:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3406:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3411:Mslnl UTSW 17 25744517 missense probably benign 0.05
R3434:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3546:Mslnl UTSW 17 25744969 missense probably damaging 0.98
R3612:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3729:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3730:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3802:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3804:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3894:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3895:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4454:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4455:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4456:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4457:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4561:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4562:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4564:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4600:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4601:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4610:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4704:Mslnl UTSW 17 25738978 missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25738968 nonsense probably null
R5257:Mslnl UTSW 17 25746165 missense probably benign 0.00
R5456:Mslnl UTSW 17 25743159 missense probably damaging 0.98
R5645:Mslnl UTSW 17 25737842 missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25746775 missense probably benign 0.00
R6083:Mslnl UTSW 17 25737902 missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25744557 missense probably damaging 1.00
R7058:Mslnl UTSW 17 25743212 missense probably benign 0.03
R7156:Mslnl UTSW 17 25743210 missense probably benign 0.20
R7467:Mslnl UTSW 17 25736921 start codon destroyed probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGTGACTAAATTCTCTAGGCCTTTC -3'
(R):5'- AAGTTCCTCCAAAGGGGCAC -3'

Sequencing Primer
(F):5'- TTTGTATCCTACAGACACCAGGAGG -3'
(R):5'- GCACCACCTAGAGGGAGTG -3'
Posted On2018-08-29