Incidental Mutation 'R6761:Uty'
ID531719
Institutional Source Beutler Lab
Gene Symbol Uty
Ensembl Gene ENSMUSG00000068457
Gene Nameubiquitously transcribed tetratricopeptide repeat gene, Y chromosome
SynonymsHydb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6761 (G1)
Quality Score221.999
Status Validated
ChromosomeY
Chromosomal Location1096861-1245759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 1186790 bp
ZygosityHomozygous
Amino Acid Change Histidine to Arginine at position 145 (H145R)
Ref Sequence ENSEMBL: ENSMUSP00000114910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069309] [ENSMUST00000137048] [ENSMUST00000139365] [ENSMUST00000143286] [ENSMUST00000143958] [ENSMUST00000154004] [ENSMUST00000154666]
Predicted Effect probably damaging
Transcript: ENSMUST00000069309
AA Change: H208R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070012
Gene: ENSMUSG00000068457
AA Change: H208R

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
TPR 88 121 1.51e1 SMART
TPR 125 158 2.26e-3 SMART
TPR 200 233 2.31e0 SMART
TPR 279 312 6.19e-1 SMART
TPR 313 346 4.21e-3 SMART
TPR 347 380 8.97e0 SMART
Blast:JmjC 389 470 2e-28 BLAST
low complexity region 534 551 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 693 705 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
low complexity region 784 795 N/A INTRINSIC
JmjC 907 1070 5.22e-47 SMART
Blast:JmjC 1106 1170 1e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000137048
AA Change: H205R
SMART Domains Protein: ENSMUSP00000119406
Gene: ENSMUSG00000068457
AA Change: H205R

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
TPR 85 118 1.51e1 SMART
TPR 122 155 2.26e-3 SMART
TPR 197 230 2.31e0 SMART
TPR 276 309 6.19e-1 SMART
TPR 310 343 4.21e-3 SMART
TPR 344 377 8.97e0 SMART
Blast:JmjC 452 647 6e-24 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000139365
AA Change: H207R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114752
Gene: ENSMUSG00000068457
AA Change: H207R

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
TPR 87 120 1.51e1 SMART
TPR 124 157 2.26e-3 SMART
TPR 199 232 2.31e0 SMART
TPR 278 311 6.19e-1 SMART
TPR 312 345 4.21e-3 SMART
TPR 346 379 8.97e0 SMART
Blast:JmjC 388 469 2e-28 BLAST
low complexity region 533 550 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 730 743 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
JmjC 906 1069 5.22e-47 SMART
Blast:JmjC 1105 1169 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143286
AA Change: H152R

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000115113
Gene: ENSMUSG00000068457
AA Change: H152R

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
TPR 69 102 2.26e-3 SMART
TPR 144 177 2.31e0 SMART
TPR 223 256 6.19e-1 SMART
TPR 257 290 4.21e-3 SMART
TPR 291 324 8.97e0 SMART
low complexity region 433 450 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 683 694 N/A INTRINSIC
JmjC 806 969 5.22e-47 SMART
Blast:JmjC 1005 1069 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143958
SMART Domains Protein: ENSMUSP00000120069
Gene: ENSMUSG00000068457

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150715
Predicted Effect probably damaging
Transcript: ENSMUST00000154004
AA Change: H145R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114910
Gene: ENSMUSG00000068457
AA Change: H145R

DomainStartEndE-ValueType
TPR 25 58 1.51e1 SMART
TPR 62 95 2.26e-3 SMART
TPR 137 170 2.31e0 SMART
TPR 216 249 6.19e-1 SMART
TPR 250 283 4.21e-3 SMART
TPR 284 317 8.97e0 SMART
Blast:JmjC 326 407 2e-28 BLAST
low complexity region 471 488 N/A INTRINSIC
low complexity region 568 583 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 668 681 N/A INTRINSIC
low complexity region 721 732 N/A INTRINSIC
JmjC 844 1007 5.22e-47 SMART
Blast:JmjC 1043 1107 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154666
SMART Domains Protein: ENSMUSP00000122818
Gene: ENSMUSG00000068457

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
MGI Phenotype PHENOTYPE: Mutant male mice hemizygous for a gene trapped allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Actr3b C T 5: 25,825,139 S67F probably damaging Het
Ap3m1 T C 14: 21,038,028 M107V probably benign Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Clec3b G T 9: 123,156,939 G134V probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Efcab14 T C 4: 115,738,827 S57P probably damaging Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 I203N possibly damaging Het
Hltf T A 3: 20,083,832 probably null Het
Igkv3-2 G T 6: 70,698,517 probably benign Het
Mslnl A G 17: 25,746,073 D471G probably damaging Het
Msmo1 A G 8: 64,719,027 Y281H probably benign Het
Nid1 A G 13: 13,482,035 T584A probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Prss45 G T 9: 110,840,419 A197S probably damaging Het
Rpap2 T A 5: 107,620,238 I314N probably benign Het
Sash1 A G 10: 8,744,522 M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 T140A probably benign Het
Other mutations in Uty
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:Uty UTSW Y 1197223 missense probably damaging 1.00
R0277:Uty UTSW Y 1169979 missense probably damaging 1.00
R0323:Uty UTSW Y 1169979 missense probably damaging 1.00
R1102:Uty UTSW Y 1174741 missense probably damaging 1.00
R1256:Uty UTSW Y 1134884 missense probably damaging 0.96
R1499:Uty UTSW Y 1197228 missense probably damaging 1.00
R1534:Uty UTSW Y 1245440 missense probably benign 0.41
R1643:Uty UTSW Y 1152054 missense probably damaging 1.00
R2070:Uty UTSW Y 1169193 missense probably benign 0.28
R2101:Uty UTSW Y 1176541 missense probably damaging 0.99
R2146:Uty UTSW Y 1239816 missense probably benign 0.25
R2508:Uty UTSW Y 1158182 missense probably damaging 1.00
R3036:Uty UTSW Y 1099671 nonsense probably null
R3437:Uty UTSW Y 1158336 missense probably benign 0.38
R3547:Uty UTSW Y 1158512 missense possibly damaging 0.78
R4153:Uty UTSW Y 1158327 missense possibly damaging 0.68
R4388:Uty UTSW Y 1151956 missense possibly damaging 0.94
R4467:Uty UTSW Y 1158372 missense possibly damaging 0.48
R4607:Uty UTSW Y 1131134 missense probably damaging 1.00
R4608:Uty UTSW Y 1131134 missense probably damaging 1.00
R4684:Uty UTSW Y 1176502 nonsense probably null
R4948:Uty UTSW Y 1136883 missense probably damaging 1.00
R5129:Uty UTSW Y 1158592 missense probably benign 0.13
R5387:Uty UTSW Y 1189339 missense probably damaging 1.00
R5408:Uty UTSW Y 1245614 missense possibly damaging 0.46
R5487:Uty UTSW Y 1174825 missense probably damaging 1.00
R5677:Uty UTSW Y 1134902 missense probably damaging 1.00
R5806:Uty UTSW Y 1170921 missense probably damaging 0.99
R6047:Uty UTSW Y 1158288 missense probably damaging 1.00
R6092:Uty UTSW Y 1174836 missense probably benign 0.08
R6759:Uty UTSW Y 1174735 missense probably damaging 0.98
R6949:Uty UTSW Y 1240000 intron probably null
Predicted Primers PCR Primer
(F):5'- CTGGAGAAAGAATGTGATCAACCTG -3'
(R):5'- AACACTCTTTCATTGGATGGGTGG -3'

Sequencing Primer
(F):5'- GCACCATGAGTTCCTTGACATG -3'
(R):5'- AGACAGGAGCCTTACTTTGC -3'
Posted On2018-08-29