Mutagenetix > Incidental Mutation

Incidental Mutation 'R6762:Sptbn4'

531741

Institutional Source

Beutler Lab

Gene Symbol

Sptbn4

Ensembl Gene

ENSMUSG00000011751

Gene Name

spectrin beta, non-erythrocytic 4

Synonyms

nmf261, 1700022P15Rik, SpbIV, ROSA62, 5830426A08Rik, dyn, neuroaxonal dystrophy, Spnb4

MMRRC Submission

044878-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.379) question?

Stock #

R6762 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27055808-27147111 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27093633 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1340 (F1340L)

Ref Sequence

ENSEMBL: ENSMUSP00000132807 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]

AlphaFold

E9PX29

Predicted Effect

probably damaging
Transcript: ENSMUST00000011895
AA Change: F1345L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: F1345L

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.4e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	642	7.62e-19	SMART
SPEC	648	766	1.31e-8	SMART
SPEC	772	874	2.94e-11	SMART
SPEC	880	980	1.49e-21	SMART
SPEC	986	1081	1.65e0	SMART
SPEC	1087	1192	2.82e-13	SMART
SPEC	1198	1298	6.59e-14	SMART
SPEC	1304	1403	4.08e-19	SMART
SPEC	1409	1508	5.92e-7	SMART
SPEC	1514	1614	2.45e-22	SMART
SPEC	1620	1720	1.45e-24	SMART
SPEC	1726	1827	1.86e-22	SMART
SPEC	1833	1935	9.54e-11	SMART
SPEC	1941	2041	1.35e-19	SMART
SPEC	2047	2297	1.06e-8	SMART
low complexity region	2358	2412	N/A	INTRINSIC
PH	2416	2526	1.54e-14	SMART
low complexity region	2549	2560	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108362
AA Change: F25L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: F25L

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108363
AA Change: F25L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: F25L

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108364
AA Change: F25L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: F25L

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172269
AA Change: F1340L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: F1340L

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.9e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	637	3.45e-17	SMART
SPEC	643	761	1.31e-8	SMART
SPEC	767	869	2.94e-11	SMART
SPEC	875	975	1.49e-21	SMART
SPEC	981	1076	1.65e0	SMART
SPEC	1082	1187	2.82e-13	SMART
SPEC	1193	1293	6.59e-14	SMART
SPEC	1299	1398	4.08e-19	SMART
SPEC	1404	1503	5.92e-7	SMART
SPEC	1509	1609	2.45e-22	SMART
SPEC	1615	1715	1.45e-24	SMART
SPEC	1721	1822	1.86e-22	SMART
SPEC	1828	1930	9.54e-11	SMART
SPEC	1936	2036	1.35e-19	SMART
SPEC	2042	2292	1.06e-8	SMART
low complexity region	2352	2406	N/A	INTRINSIC
PH	2410	2520	1.54e-14	SMART
low complexity region	2543	2554	N/A	INTRINSIC

Meta Mutation Damage Score

0.3884

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr4	A	G	9: 103,976,867 (GRCm39)	Y27H	probably benign	Het
Angptl3	T	A	4: 98,925,654 (GRCm39)	S327T	possibly damaging	Het
Arl6ip4	GGAAGAAGAAGAAGAAGAA	GGAAGAAGAAGAAGAAGAAGAA	5: 124,255,113 (GRCm39)		probably benign	Het
Cyp2s1	A	T	7: 25,507,495 (GRCm39)	L318H	probably damaging	Het
Dnah14	T	C	1: 181,584,824 (GRCm39)	L3185P	probably damaging	Het
Dnah7b	T	C	1: 46,263,902 (GRCm39)	V2128A	probably benign	Het
Ehhadh	A	T	16: 21,581,209 (GRCm39)	F594L	probably benign	Het
En2	A	G	5: 28,375,351 (GRCm39)	N298S	possibly damaging	Het
Epha5	T	A	5: 84,479,585 (GRCm39)	N140Y	probably damaging	Het
Fam151b	C	T	13: 92,604,558 (GRCm39)	V144I	possibly damaging	Het
Fanca	C	A	8: 123,998,042 (GRCm39)	A1215S	probably benign	Het
Fancd2	T	A	6: 113,562,977 (GRCm39)		probably null	Het
Fat2	T	C	11: 55,144,308 (GRCm39)		probably null	Het
Gm4513	T	C	7: 20,328,118 (GRCm39)	N31S	probably benign	Het
Hspg2	A	T	4: 137,279,114 (GRCm39)	I3066F	possibly damaging	Het
Krt10	T	C	11: 99,277,883 (GRCm39)	T355A	possibly damaging	Het
Lims1	C	A	10: 58,248,367 (GRCm39)	H275N	probably damaging	Het
Map3k19	C	T	1: 127,775,001 (GRCm39)	G112D	probably damaging	Het
Mdn1	T	A	4: 32,676,786 (GRCm39)	N619K	possibly damaging	Het
Mtor	A	G	4: 148,622,938 (GRCm39)	T1977A	possibly damaging	Het
Nos2	T	G	11: 78,850,574 (GRCm39)	L1144R	possibly damaging	Het
Or52ae7	G	C	7: 103,119,596 (GRCm39)	V117L	probably benign	Het
Or6c68	G	A	10: 129,158,125 (GRCm39)	C211Y	probably damaging	Het
Or8k38	A	T	2: 86,488,188 (GRCm39)	F205I	probably benign	Het
Pals2	T	A	6: 50,157,418 (GRCm39)		probably null	Het
Pcdhga9	C	A	18: 37,870,321 (GRCm39)	S50Y	probably damaging	Het
Pfn4	T	A	12: 4,825,487 (GRCm39)	M108K	probably damaging	Het
Prep	T	C	10: 45,024,219 (GRCm39)		probably null	Het
Qtrt1	T	A	9: 21,323,378 (GRCm39)	H76Q	probably damaging	Het
Rpa1	T	A	11: 75,231,171 (GRCm39)	S73C	possibly damaging	Het
Senp5	A	G	16: 31,808,702 (GRCm39)	V157A	probably damaging	Het
Snapc3	T	C	4: 83,353,495 (GRCm39)	L178P	probably damaging	Het
Srd5a3	T	A	5: 76,301,398 (GRCm39)	I85K	probably benign	Het
Taar2	C	T	10: 23,817,300 (GRCm39)	T280M	probably damaging	Het
Tgfb3	T	C	12: 86,116,237 (GRCm39)	D177G	probably benign	Het
Tpt1	A	G	14: 76,083,821 (GRCm39)	D94G	probably benign	Het
Trpm4	A	G	7: 44,954,240 (GRCm39)		probably benign	Het
Trpv4	C	T	5: 114,763,171 (GRCm39)	R746H	probably benign	Het
Txndc2	T	C	17: 65,945,967 (GRCm39)	D70G	probably damaging	Het
Ugcg	T	A	4: 59,219,530 (GRCm39)	I289N	possibly damaging	Het
Vmn2r2	C	G	3: 64,041,870 (GRCm39)	D282H	probably damaging	Het
Vmn2r50	A	T	7: 9,787,010 (GRCm39)	N32K	probably benign	Het
Wdpcp	C	T	11: 21,671,244 (GRCm39)	T495I	probably benign	Het
Zfp961	T	A	8: 72,719,958 (GRCm39)	C51S	possibly damaging	Het
Zxdc	C	T	6: 90,359,165 (GRCm39)	A599V	probably benign	Het

Other mutations in Sptbn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sptbn4	APN	7	27,068,859 (GRCm39)	missense	probably damaging	1.00
IGL00468:Sptbn4	APN	7	27,117,390 (GRCm39)	missense	probably damaging	1.00
IGL01396:Sptbn4	APN	7	27,114,196 (GRCm39)	missense	probably benign	0.06
IGL01700:Sptbn4	APN	7	27,103,693 (GRCm39)	missense	probably damaging	1.00
IGL01878:Sptbn4	APN	7	27,063,571 (GRCm39)	missense	probably damaging	0.99
IGL02066:Sptbn4	APN	7	27,063,940 (GRCm39)	missense	possibly damaging	0.68
IGL02116:Sptbn4	APN	7	27,063,782 (GRCm39)	missense	probably benign
IGL02226:Sptbn4	APN	7	27,065,132 (GRCm39)	missense	probably damaging	1.00
IGL02333:Sptbn4	APN	7	27,063,724 (GRCm39)	missense	probably damaging	1.00
IGL02337:Sptbn4	APN	7	27,127,672 (GRCm39)	missense	probably benign	0.03
IGL02451:Sptbn4	APN	7	27,065,014 (GRCm39)	missense	probably null	0.15
IGL02487:Sptbn4	APN	7	27,118,522 (GRCm39)	missense	probably damaging	1.00
IGL02530:Sptbn4	APN	7	27,090,976 (GRCm39)	missense	probably damaging	1.00
IGL02724:Sptbn4	APN	7	27,067,104 (GRCm39)	missense	probably damaging	1.00
IGL02850:Sptbn4	APN	7	27,126,258 (GRCm39)	missense	possibly damaging	0.95
IGL02851:Sptbn4	APN	7	27,126,258 (GRCm39)	missense	possibly damaging	0.95
IGL02869:Sptbn4	APN	7	27,093,573 (GRCm39)	splice site	probably benign
IGL02961:Sptbn4	APN	7	27,097,392 (GRCm39)	missense	probably damaging	1.00
ANU22:Sptbn4	UTSW	7	27,056,812 (GRCm39)	nonsense	probably null
R0194:Sptbn4	UTSW	7	27,104,336 (GRCm39)	missense	probably benign	0.00
R0328:Sptbn4	UTSW	7	27,063,595 (GRCm39)	missense	probably damaging	1.00
R0379:Sptbn4	UTSW	7	27,059,161 (GRCm39)	splice site	probably benign
R0510:Sptbn4	UTSW	7	27,060,991 (GRCm39)	critical splice donor site	probably null
R0550:Sptbn4	UTSW	7	27,063,803 (GRCm39)	missense	probably benign	0.16
R0557:Sptbn4	UTSW	7	27,107,753 (GRCm39)	nonsense	probably null
R1336:Sptbn4	UTSW	7	27,117,388 (GRCm39)	missense	probably damaging	1.00
R1494:Sptbn4	UTSW	7	27,133,719 (GRCm39)	missense	probably damaging	1.00
R1630:Sptbn4	UTSW	7	27,118,164 (GRCm39)	missense	probably benign	0.09
R1803:Sptbn4	UTSW	7	27,118,008 (GRCm39)	missense	probably damaging	1.00
R1834:Sptbn4	UTSW	7	27,066,071 (GRCm39)	missense	probably null	0.96
R1906:Sptbn4	UTSW	7	27,090,856 (GRCm39)	critical splice donor site	probably null
R1924:Sptbn4	UTSW	7	27,106,563 (GRCm39)	missense	probably damaging	1.00
R1951:Sptbn4	UTSW	7	27,065,868 (GRCm39)	missense	possibly damaging	0.64
R1989:Sptbn4	UTSW	7	27,067,127 (GRCm39)	missense	probably damaging	1.00
R1990:Sptbn4	UTSW	7	27,123,235 (GRCm39)	missense	probably benign	0.19
R2005:Sptbn4	UTSW	7	27,065,844 (GRCm39)	nonsense	probably null
R2083:Sptbn4	UTSW	7	27,127,681 (GRCm39)	missense	probably benign	0.29
R2176:Sptbn4	UTSW	7	27,063,587 (GRCm39)	missense	probably benign	0.21
R2211:Sptbn4	UTSW	7	27,067,034 (GRCm39)	missense	probably damaging	1.00
R2262:Sptbn4	UTSW	7	27,133,782 (GRCm39)	missense	probably damaging	1.00
R2263:Sptbn4	UTSW	7	27,133,782 (GRCm39)	missense	probably damaging	1.00
R2374:Sptbn4	UTSW	7	27,059,517 (GRCm39)	missense	probably damaging	0.99
R2407:Sptbn4	UTSW	7	27,117,523 (GRCm39)	nonsense	probably null
R4115:Sptbn4	UTSW	7	27,090,995 (GRCm39)	missense	probably damaging	1.00
R4116:Sptbn4	UTSW	7	27,090,995 (GRCm39)	missense	probably damaging	1.00
R4392:Sptbn4	UTSW	7	27,117,896 (GRCm39)	missense	probably damaging	0.97
R4426:Sptbn4	UTSW	7	27,123,223 (GRCm39)	missense	probably damaging	1.00
R4535:Sptbn4	UTSW	7	27,067,127 (GRCm39)	missense	probably damaging	1.00
R4684:Sptbn4	UTSW	7	27,066,160 (GRCm39)	missense	possibly damaging	0.60
R4684:Sptbn4	UTSW	7	27,063,844 (GRCm39)	missense	probably damaging	0.96
R4707:Sptbn4	UTSW	7	27,116,431 (GRCm39)	missense	probably benign	0.12
R4876:Sptbn4	UTSW	7	27,071,577 (GRCm39)	missense	probably damaging	1.00
R5091:Sptbn4	UTSW	7	27,068,816 (GRCm39)	missense	probably damaging	1.00
R5371:Sptbn4	UTSW	7	27,059,166 (GRCm39)	critical splice donor site	probably null
R5790:Sptbn4	UTSW	7	27,065,853 (GRCm39)	missense	probably damaging	0.99
R5857:Sptbn4	UTSW	7	27,118,138 (GRCm39)	missense	possibly damaging	0.89
R5908:Sptbn4	UTSW	7	27,103,678 (GRCm39)	missense	probably benign	0.00
R5980:Sptbn4	UTSW	7	27,071,596 (GRCm39)	missense	probably damaging	1.00
R6005:Sptbn4	UTSW	7	27,118,024 (GRCm39)	missense	probably damaging	1.00
R6013:Sptbn4	UTSW	7	27,063,904 (GRCm39)	missense	probably damaging	0.99
R6037:Sptbn4	UTSW	7	27,063,595 (GRCm39)	missense	probably damaging	0.97
R6037:Sptbn4	UTSW	7	27,063,595 (GRCm39)	missense	probably damaging	0.97
R6129:Sptbn4	UTSW	7	27,059,513 (GRCm39)	missense	probably damaging	0.98
R6146:Sptbn4	UTSW	7	27,064,012 (GRCm39)	nonsense	probably null
R6897:Sptbn4	UTSW	7	27,071,375 (GRCm39)	missense	possibly damaging	0.96
R7178:Sptbn4	UTSW	7	27,117,481 (GRCm39)	missense	probably damaging	1.00
R7212:Sptbn4	UTSW	7	27,116,210 (GRCm39)	missense	probably benign	0.44
R7465:Sptbn4	UTSW	7	27,066,114 (GRCm39)	missense	probably benign	0.00
R7471:Sptbn4	UTSW	7	27,108,439 (GRCm39)	missense	possibly damaging	0.64
R7510:Sptbn4	UTSW	7	27,127,693 (GRCm39)	missense	probably benign	0.13
R7527:Sptbn4	UTSW	7	27,075,015 (GRCm39)	missense	possibly damaging	0.94
R7528:Sptbn4	UTSW	7	27,141,960 (GRCm39)	missense	probably benign	0.00
R7572:Sptbn4	UTSW	7	27,071,697 (GRCm39)	missense	probably damaging	0.99
R7649:Sptbn4	UTSW	7	27,061,002 (GRCm39)	missense	possibly damaging	0.80
R7714:Sptbn4	UTSW	7	27,063,761 (GRCm39)	missense	probably benign	0.02
R7780:Sptbn4	UTSW	7	27,061,059 (GRCm39)	missense	possibly damaging	0.70
R7854:Sptbn4	UTSW	7	27,061,835 (GRCm39)	missense	probably benign
R8002:Sptbn4	UTSW	7	27,117,417 (GRCm39)	missense	possibly damaging	0.91
R8058:Sptbn4	UTSW	7	27,063,694 (GRCm39)	missense	possibly damaging	0.92
R8181:Sptbn4	UTSW	7	27,074,808 (GRCm39)	missense	possibly damaging	0.79
R8195:Sptbn4	UTSW	7	27,108,314 (GRCm39)	nonsense	probably null
R8353:Sptbn4	UTSW	7	27,103,663 (GRCm39)	missense	probably damaging	1.00
R8392:Sptbn4	UTSW	7	27,071,721 (GRCm39)	missense	probably damaging	1.00
R8453:Sptbn4	UTSW	7	27,103,663 (GRCm39)	missense	probably damaging	1.00
R8815:Sptbn4	UTSW	7	27,106,657 (GRCm39)	nonsense	probably null
R8818:Sptbn4	UTSW	7	27,063,592 (GRCm39)	missense	possibly damaging	0.71
R9171:Sptbn4	UTSW	7	27,141,844 (GRCm39)	missense	possibly damaging	0.95
R9259:Sptbn4	UTSW	7	27,067,124 (GRCm39)	missense	possibly damaging	0.74
R9477:Sptbn4	UTSW	7	27,132,624 (GRCm39)	missense	possibly damaging	0.79
R9564:Sptbn4	UTSW	7	27,117,504 (GRCm39)	missense	probably damaging	0.98
R9572:Sptbn4	UTSW	7	27,066,095 (GRCm39)	missense	probably benign	0.16
R9623:Sptbn4	UTSW	7	27,107,807 (GRCm39)	missense	probably damaging	1.00
R9715:Sptbn4	UTSW	7	27,091,000 (GRCm39)	missense	probably damaging	1.00
R9782:Sptbn4	UTSW	7	27,107,993 (GRCm39)	missense	probably benign	0.02
R9790:Sptbn4	UTSW	7	27,071,662 (GRCm39)	missense	probably damaging	0.99
R9791:Sptbn4	UTSW	7	27,071,662 (GRCm39)	missense	probably damaging	0.99
R9798:Sptbn4	UTSW	7	27,056,717 (GRCm39)	makesense	probably null
X0020:Sptbn4	UTSW	7	27,102,159 (GRCm39)	critical splice donor site	probably null
X0066:Sptbn4	UTSW	7	27,056,736 (GRCm39)	unclassified	probably benign
Z1176:Sptbn4	UTSW	7	27,059,450 (GRCm39)	missense	probably damaging	0.99
Z1177:Sptbn4	UTSW	7	27,108,527 (GRCm39)	missense	probably benign	0.41
Z1177:Sptbn4	UTSW	7	27,104,007 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTGAACCCAGGGTTTCCC -3'
(R):5'- AACCTGAAGTTCTTGAGGGG -3'

Sequencing Primer
(F):5'- CCCTTGTACAGATGGGCAAACTG -3'
(R):5'- CCTGAAGTTCTTGAGGGGTGTTTTG -3'

Posted On

2018-08-29