Incidental Mutation 'R6763:Lrba'
ID531770
Institutional Source Beutler Lab
Gene Symbol Lrba
Ensembl Gene ENSMUSG00000028080
Gene NameLPS-responsive beige-like anchor
SynonymsLba, D3Ertd775e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R6763 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location86224680-86782692 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86354263 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1508 (D1508G)
Ref Sequence ENSEMBL: ENSMUSP00000142179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000212390]
Predicted Effect probably damaging
Transcript: ENSMUST00000107635
AA Change: D1508G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: D1508G

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192145
AA Change: D1508G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: D1508G

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 7.4e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.5e-92 PFAM
Pfam:PH_BEACH 2068 2172 7.5e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194759
AA Change: D1508G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: D1508G

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212390
AA Change: D1508G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C A 15: 102,340,022 R286L probably null Het
Actrt2 A G 4: 154,667,379 V100A probably damaging Het
Adra1b A G 11: 43,776,006 L468P possibly damaging Het
Ankhd1 A G 18: 36,642,969 E1457G probably benign Het
Aspm A T 1: 139,470,517 M974L possibly damaging Het
Atp8a2 T A 14: 60,008,408 I612F probably benign Het
Cabin1 A G 10: 75,746,730 L284P probably damaging Het
Cand2 T A 6: 115,799,969 M1106K probably benign Het
Ccbe1 A T 18: 66,061,388 F376I possibly damaging Het
Ceacam14 A G 7: 17,815,343 T220A probably benign Het
Celsr3 A G 9: 108,827,350 D344G probably damaging Het
Chaf1b A G 16: 93,891,505 K163E probably damaging Het
Clec2d C A 6: 129,184,144 T68K probably benign Het
Cwc27 T C 13: 104,811,301 T19A probably damaging Het
Dnah7c A T 1: 46,628,890 Y1519F possibly damaging Het
E130308A19Rik A T 4: 59,752,288 K467M probably damaging Het
Fam129b T C 2: 32,911,448 probably null Het
Garnl3 T C 2: 33,054,196 Y117C probably damaging Het
Gas2l3 T C 10: 89,413,369 Y629C probably benign Het
Lama1 A G 17: 67,746,873 N470D unknown Het
Lmtk2 T A 5: 144,173,797 I445N probably damaging Het
Muc5b A G 7: 141,862,284 H2989R probably benign Het
Nln A T 13: 104,035,655 W638R probably damaging Het
Nup133 T C 8: 123,944,278 I127V possibly damaging Het
Nup155 C T 15: 8,135,895 R672* probably null Het
Prkcb A G 7: 122,594,664 Y532C probably damaging Het
Ptpro A G 6: 137,418,281 probably null Het
Rab11fip5 A G 6: 85,342,170 L579S probably benign Het
Rtca A G 3: 116,507,749 probably null Het
Sdccag8 A G 1: 176,854,627 probably null Het
Svil G T 18: 5,056,437 D524Y probably damaging Het
Unc80 A G 1: 66,521,477 N788S probably benign Het
Wdfy4 G T 14: 33,042,512 R2140S probably damaging Het
Zfp518a A G 19: 40,913,748 K707R probably damaging Het
Other mutations in Lrba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lrba APN 3 86359782 missense probably benign 0.00
IGL00788:Lrba APN 3 86327685 missense probably damaging 0.97
IGL01139:Lrba APN 3 86642662 missense possibly damaging 0.88
IGL01302:Lrba APN 3 86295400 missense probably damaging 1.00
IGL01612:Lrba APN 3 86776177 missense possibly damaging 0.89
IGL01718:Lrba APN 3 86351248 missense probably damaging 1.00
IGL01719:Lrba APN 3 86327596 splice site probably benign
IGL01730:Lrba APN 3 86741424 missense possibly damaging 0.89
IGL01735:Lrba APN 3 86327661 missense probably benign 0.28
IGL01875:Lrba APN 3 86310047 missense probably damaging 1.00
IGL01884:Lrba APN 3 86310412 missense possibly damaging 0.86
IGL02264:Lrba APN 3 86780262 missense probably damaging 0.99
IGL02638:Lrba APN 3 86325073 missense probably damaging 0.97
IGL02647:Lrba APN 3 86359731 missense probably benign 0.00
IGL02664:Lrba APN 3 86325731 missense possibly damaging 0.84
IGL02728:Lrba APN 3 86776049 missense probably damaging 0.99
IGL02730:Lrba APN 3 86328199 missense probably damaging 1.00
IGL02883:Lrba APN 3 86354206 missense probably damaging 1.00
IGL02883:Lrba APN 3 86445413 missense probably damaging 0.99
IGL02948:Lrba APN 3 86310384 splice site probably null
IGL03090:Lrba APN 3 86773141 missense probably benign 0.01
oscar UTSW 3 86350304 nonsense probably null
oscar2 UTSW 3 86664458 nonsense probably null
P0023:Lrba UTSW 3 86417935 missense probably damaging 1.00
R0077:Lrba UTSW 3 86542688 missense probably damaging 0.99
R0189:Lrba UTSW 3 86368509 missense probably damaging 1.00
R0217:Lrba UTSW 3 86642722 missense probably damaging 1.00
R0349:Lrba UTSW 3 86540005 missense probably damaging 1.00
R0396:Lrba UTSW 3 86295179 missense probably damaging 1.00
R0417:Lrba UTSW 3 86715654 missense probably damaging 1.00
R0536:Lrba UTSW 3 86715532 missense probably damaging 1.00
R0712:Lrba UTSW 3 86297990 nonsense probably null
R0722:Lrba UTSW 3 86605989 critical splice donor site probably null
R0828:Lrba UTSW 3 86608370 synonymous probably null
R0927:Lrba UTSW 3 86780233 missense probably damaging 1.00
R1120:Lrba UTSW 3 86295192 missense probably damaging 1.00
R1141:Lrba UTSW 3 86619558 missense probably damaging 1.00
R1276:Lrba UTSW 3 86664526 missense probably damaging 1.00
R1449:Lrba UTSW 3 86354278 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1474:Lrba UTSW 3 86780266 splice site probably benign
R1558:Lrba UTSW 3 86351315 missense probably damaging 1.00
R1596:Lrba UTSW 3 86350304 nonsense probably null
R1652:Lrba UTSW 3 86539938 missense probably damaging 1.00
R1800:Lrba UTSW 3 86351868 missense probably benign 0.00
R1819:Lrba UTSW 3 86542634 missense possibly damaging 0.80
R1862:Lrba UTSW 3 86773203 critical splice donor site probably null
R1917:Lrba UTSW 3 86664501 missense probably damaging 1.00
R1965:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1966:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1969:Lrba UTSW 3 86608389 missense probably damaging 0.99
R2011:Lrba UTSW 3 86310017 missense probably damaging 0.99
R2179:Lrba UTSW 3 86354281 missense probably damaging 1.00
R2186:Lrba UTSW 3 86304336 missense probably damaging 1.00
R2281:Lrba UTSW 3 86776103 missense possibly damaging 0.46
R2359:Lrba UTSW 3 86348750 missense probably benign 0.01
R2412:Lrba UTSW 3 86327700 missense probably damaging 1.00
R2496:Lrba UTSW 3 86532087 missense probably damaging 1.00
R3153:Lrba UTSW 3 86285219 missense probably damaging 0.99
R3708:Lrba UTSW 3 86285024 missense possibly damaging 0.80
R3746:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3747:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3748:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3749:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3750:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3758:Lrba UTSW 3 86776049 missense probably damaging 0.99
R3975:Lrba UTSW 3 86351255 missense probably damaging 1.00
R4210:Lrba UTSW 3 86360126 missense probably damaging 1.00
R4258:Lrba UTSW 3 86445349 missense probably damaging 1.00
R4657:Lrba UTSW 3 86737164 missense probably damaging 1.00
R4713:Lrba UTSW 3 86359868 missense probably benign 0.13
R4716:Lrba UTSW 3 86642714 missense probably damaging 0.99
R4811:Lrba UTSW 3 86776141 missense probably damaging 1.00
R4827:Lrba UTSW 3 86360150 missense possibly damaging 0.85
R4840:Lrba UTSW 3 86619509 critical splice acceptor site probably null
R4920:Lrba UTSW 3 86664458 nonsense probably null
R4948:Lrba UTSW 3 86285028 missense probably damaging 1.00
R4970:Lrba UTSW 3 86225371 missense probably benign 0.23
R4985:Lrba UTSW 3 86327436 intron probably null
R4993:Lrba UTSW 3 86360037 missense probably damaging 1.00
R5107:Lrba UTSW 3 86359779 missense possibly damaging 0.47
R5112:Lrba UTSW 3 86225371 missense probably benign 0.23
R5122:Lrba UTSW 3 86349154 nonsense probably null
R5155:Lrba UTSW 3 86351300 missense probably benign 0.25
R5194:Lrba UTSW 3 86328219 missense probably damaging 1.00
R5280:Lrba UTSW 3 86325022 missense possibly damaging 0.94
R5445:Lrba UTSW 3 86368595 missense probably benign
R5469:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5513:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5578:Lrba UTSW 3 86757507 missense probably benign 0.27
R5740:Lrba UTSW 3 86328342 missense probably damaging 1.00
R5868:Lrba UTSW 3 86319604 missense probably damaging 1.00
R6104:Lrba UTSW 3 86353792 missense probably damaging 1.00
R6166:Lrba UTSW 3 86354307 critical splice donor site probably null
R6279:Lrba UTSW 3 86348864 missense probably benign 0.26
R6330:Lrba UTSW 3 86348357 missense probably benign 0.07
R6367:Lrba UTSW 3 86368562 missense probably benign 0.42
R6571:Lrba UTSW 3 86360060 missense probably damaging 1.00
R6584:Lrba UTSW 3 86664576 missense probably damaging 1.00
R6698:Lrba UTSW 3 86304425 missense probably damaging 0.99
R6834:Lrba UTSW 3 86350286 missense probably benign 0.00
R6951:Lrba UTSW 3 86745873 missense probably benign 0.01
R6969:Lrba UTSW 3 86619590 missense probably benign 0.21
X0065:Lrba UTSW 3 86297899 missense probably damaging 1.00
X0065:Lrba UTSW 3 86325089 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCATATTCAGCTCCTGCAAG -3'
(R):5'- GTTCCAAGAAACCTGGCTTCG -3'

Sequencing Primer
(F):5'- CTCCTGCAAGGAAAGGAGACTTATG -3'
(R):5'- ACAGGAAGCATGTACCAG -3'
Posted On2018-08-29