Incidental Mutation 'R6763:Nln'
ID531787
Institutional Source Beutler Lab
Gene Symbol Nln
Ensembl Gene ENSMUSG00000021710
Gene Nameneurolysin (metallopeptidase M3 family)
Synonyms4930472G13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6763 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location104023057-104109614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104035655 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 638 (W638R)
Ref Sequence ENSEMBL: ENSMUSP00000153227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109315] [ENSMUST00000224945]
Predicted Effect probably damaging
Transcript: ENSMUST00000109315
AA Change: W638R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104938
Gene: ENSMUSG00000021710
AA Change: W638R

DomainStartEndE-ValueType
Pfam:Peptidase_M3 251 701 1.8e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224945
AA Change: W638R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225324
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the metallopeptidase M3 protein family that cleaves neurotensin at the Pro10-Tyr11 bond, leading to the formation of neurotensin(1-10) and neurotensin(11-13). The encoded protein is likely involved in the termination of the neurotensinergic signal in the central nervous system and in the gastrointestinal tract.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit increased glucose tolerance, insulin sensitivity, and gluconeogensis. Mice also show decreased body weight and run less in a low intensity regime to exhaustion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C A 15: 102,340,022 R286L probably null Het
Actrt2 A G 4: 154,667,379 V100A probably damaging Het
Adra1b A G 11: 43,776,006 L468P possibly damaging Het
Ankhd1 A G 18: 36,642,969 E1457G probably benign Het
Aspm A T 1: 139,470,517 M974L possibly damaging Het
Atp8a2 T A 14: 60,008,408 I612F probably benign Het
Cabin1 A G 10: 75,746,730 L284P probably damaging Het
Cand2 T A 6: 115,799,969 M1106K probably benign Het
Ccbe1 A T 18: 66,061,388 F376I possibly damaging Het
Ceacam14 A G 7: 17,815,343 T220A probably benign Het
Celsr3 A G 9: 108,827,350 D344G probably damaging Het
Chaf1b A G 16: 93,891,505 K163E probably damaging Het
Clec2d C A 6: 129,184,144 T68K probably benign Het
Cwc27 T C 13: 104,811,301 T19A probably damaging Het
Dnah7c A T 1: 46,628,890 Y1519F possibly damaging Het
E130308A19Rik A T 4: 59,752,288 K467M probably damaging Het
Fam129b T C 2: 32,911,448 probably null Het
Garnl3 T C 2: 33,054,196 Y117C probably damaging Het
Gas2l3 T C 10: 89,413,369 Y629C probably benign Het
Lama1 A G 17: 67,746,873 N470D unknown Het
Lmtk2 T A 5: 144,173,797 I445N probably damaging Het
Lrba A G 3: 86,354,263 D1508G probably damaging Het
Muc5b A G 7: 141,862,284 H2989R probably benign Het
Nup133 T C 8: 123,944,278 I127V possibly damaging Het
Nup155 C T 15: 8,135,895 R672* probably null Het
Prkcb A G 7: 122,594,664 Y532C probably damaging Het
Ptpro A G 6: 137,418,281 probably null Het
Rab11fip5 A G 6: 85,342,170 L579S probably benign Het
Rtca A G 3: 116,507,749 probably null Het
Sdccag8 A G 1: 176,854,627 probably null Het
Svil G T 18: 5,056,437 D524Y probably damaging Het
Unc80 A G 1: 66,521,477 N788S probably benign Het
Wdfy4 G T 14: 33,042,512 R2140S probably damaging Het
Zfp518a A G 19: 40,913,748 K707R probably damaging Het
Other mutations in Nln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Nln APN 13 104035645 missense probably damaging 1.00
IGL01656:Nln APN 13 104061741 splice site probably null
R0025:Nln UTSW 13 104036891 missense probably damaging 0.98
R0294:Nln UTSW 13 104052579 missense probably damaging 1.00
R1396:Nln UTSW 13 104061753 missense probably benign 0.01
R1657:Nln UTSW 13 104036947 missense possibly damaging 0.94
R2087:Nln UTSW 13 104037369 missense probably damaging 0.96
R2847:Nln UTSW 13 104025025 missense probably damaging 1.00
R3034:Nln UTSW 13 104037439 missense possibly damaging 0.91
R5576:Nln UTSW 13 104058830 missense probably damaging 1.00
R5585:Nln UTSW 13 104025061 missense possibly damaging 0.73
R5882:Nln UTSW 13 104059498 missense probably benign 0.08
R7209:Nln UTSW 13 104072898 nonsense probably null
R7347:Nln UTSW 13 104050847 missense probably damaging 0.96
X0020:Nln UTSW 13 104061810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCTACTAAGTCTCTTACTCG -3'
(R):5'- GGTACATGCCAACCAGTGAG -3'

Sequencing Primer
(F):5'- AAGTCTCTTACTCGAAACTCTAGC -3'
(R):5'- TGCATGCCAACCTGTGAGATG -3'
Posted On2018-08-29