Incidental Mutation 'R6764:Snap91'
ID531823
Institutional Source Beutler Lab
Gene Symbol Snap91
Ensembl Gene ENSMUSG00000033419
Gene Namesynaptosomal-associated protein 91
SynonymsF1-20, AP180, 91kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R6764 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location86765923-86880654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86792181 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 584 (I584T)
Ref Sequence ENSEMBL: ENSMUSP00000074066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036347] [ENSMUST00000074468] [ENSMUST00000074501] [ENSMUST00000098495]
Predicted Effect probably benign
Transcript: ENSMUST00000036347
AA Change: I584T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046189
Gene: ENSMUSG00000033419
AA Change: I584T

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 3.27e-5 PROSPERO
internal_repeat_1 584 611 3.27e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 728 757 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 850 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074468
AA Change: I584T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074066
Gene: ENSMUSG00000033419
AA Change: I584T

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 6.86e-5 PROSPERO
internal_repeat_1 584 611 6.86e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
low complexity region 733 762 N/A INTRINSIC
low complexity region 833 847 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074501
SMART Domains Protein: ENSMUSP00000074095
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 355 382 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 440 469 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000098495
AA Change: I577T
SMART Domains Protein: ENSMUSP00000096096
Gene: ENSMUSG00000033419
AA Change: I577T

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
low complexity region 396 426 N/A INTRINSIC
low complexity region 432 459 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
low complexity region 492 551 N/A INTRINSIC
internal_repeat_1 552 579 4.67e-5 PROSPERO
internal_repeat_1 577 604 4.67e-5 PROSPERO
low complexity region 609 627 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
low complexity region 698 727 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
low complexity region 820 832 N/A INTRINSIC
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display postnatal growth retardation, limb clasping, altered behavior, defects in synaptic vesicle reformation, impaired neurotransmission, excitatory/inhibitory imbalance, epileptic seizures, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A G 19: 5,502,872 S294P probably damaging Het
Aff4 G T 11: 53,399,830 R539L probably damaging Het
Aox2 T A 1: 58,350,282 Y1147N probably damaging Het
Arhgef25 A G 10: 127,184,101 F423L probably damaging Het
Atp1a2 A T 1: 172,284,614 D571E probably benign Het
Bank1 A G 3: 136,242,940 S159P probably damaging Het
Bcan C A 3: 87,988,378 R817L probably damaging Het
Cacna1g A G 11: 94,413,188 S1990P possibly damaging Het
Ccna1 G A 3: 55,046,078 T368M probably damaging Het
Chia1 T C 3: 106,130,740 probably null Het
Ctbp1 T C 5: 33,259,245 H136R possibly damaging Het
Dner T G 1: 84,494,781 D366A probably damaging Het
Eif3d A T 15: 77,961,686 D378E probably damaging Het
Evpl A G 11: 116,222,944 S1307P probably damaging Het
Fgd5 T A 6: 91,989,421 N720K probably damaging Het
Fmn1 A G 2: 113,525,215 E667G unknown Het
Gm4846 A G 1: 166,491,552 C206R probably benign Het
Grpel1 G A 5: 36,465,225 R11H probably benign Het
Gsn A G 2: 35,284,044 Y55C probably damaging Het
Hephl1 G A 9: 15,088,921 T345I possibly damaging Het
Ints2 T A 11: 86,212,779 K1150N probably benign Het
Itga4 C A 2: 79,325,614 H975N probably benign Het
Musk T C 4: 58,354,027 V360A probably damaging Het
Naalad2 A T 9: 18,402,889 probably benign Het
Ninj2 G T 6: 120,198,050 A51S probably benign Het
Pcdhac1 T C 18: 37,090,679 Y182H probably damaging Het
Pitpnm3 A G 11: 72,051,233 F916S probably damaging Het
Sfrp5 T A 19: 42,199,799 M194L probably benign Het
Sigirr C T 7: 141,093,242 V99I probably benign Het
Smco2 A G 6: 146,871,329 D343G probably damaging Het
Syne1 G A 10: 5,229,011 Q4488* probably null Het
Tbc1d24 A C 17: 24,185,780 F130C possibly damaging Het
Trpm7 A G 2: 126,844,420 V296A possibly damaging Het
Ttll11 T C 2: 35,890,448 probably null Het
Vmn2r115 A G 17: 23,346,072 D311G probably damaging Het
Vmn2r63 A G 7: 42,903,271 S854P probably damaging Het
Zfp330 C T 8: 82,767,305 C109Y probably damaging Het
Zfp534 C T 4: 147,674,718 G498D probably benign Het
Zfp62 A G 11: 49,215,169 D29G probably damaging Het
Other mutations in Snap91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Snap91 APN 9 86821737 missense probably benign 0.01
IGL01147:Snap91 APN 9 86798558 missense probably benign 0.37
IGL01358:Snap91 APN 9 86806560 missense probably damaging 1.00
IGL01501:Snap91 APN 9 86838125 missense probably damaging 0.99
IGL01883:Snap91 APN 9 86775612 missense probably damaging 1.00
IGL02632:Snap91 APN 9 86839522 missense possibly damaging 0.94
IGL02864:Snap91 APN 9 86838088 missense possibly damaging 0.95
IGL03276:Snap91 APN 9 86825012 missense possibly damaging 0.78
PIT4514001:Snap91 UTSW 9 86879433 missense possibly damaging 0.86
R1564:Snap91 UTSW 9 86792196 missense possibly damaging 0.85
R1804:Snap91 UTSW 9 86783417 missense probably benign 0.01
R1840:Snap91 UTSW 9 86815465 missense probably damaging 1.00
R1869:Snap91 UTSW 9 86790141 critical splice acceptor site probably null
R2156:Snap91 UTSW 9 86825077 missense probably damaging 1.00
R2221:Snap91 UTSW 9 86792527 missense possibly damaging 0.53
R2223:Snap91 UTSW 9 86792527 missense possibly damaging 0.53
R2233:Snap91 UTSW 9 86798571 missense probably benign 0.23
R2680:Snap91 UTSW 9 86879550 start codon destroyed probably null 1.00
R3077:Snap91 UTSW 9 86838854 missense possibly damaging 0.95
R3702:Snap91 UTSW 9 86806520 missense probably damaging 0.99
R3840:Snap91 UTSW 9 86839565 missense probably damaging 1.00
R3912:Snap91 UTSW 9 86792557 missense possibly damaging 0.53
R3913:Snap91 UTSW 9 86792557 missense possibly damaging 0.53
R3958:Snap91 UTSW 9 86838130 missense probably damaging 1.00
R3963:Snap91 UTSW 9 86775612 missense probably damaging 1.00
R4043:Snap91 UTSW 9 86777049 missense probably damaging 1.00
R4133:Snap91 UTSW 9 86777049 missense probably damaging 1.00
R4641:Snap91 UTSW 9 86879475 missense probably damaging 1.00
R4674:Snap91 UTSW 9 86792017 missense possibly damaging 0.73
R4770:Snap91 UTSW 9 86773601 missense possibly damaging 0.86
R4798:Snap91 UTSW 9 86783454 intron probably benign
R4849:Snap91 UTSW 9 86792560 missense possibly damaging 0.53
R4991:Snap91 UTSW 9 86790154 splice site probably null
R5200:Snap91 UTSW 9 86815444 missense probably damaging 1.00
R5354:Snap91 UTSW 9 86835124 missense possibly damaging 0.84
R5644:Snap91 UTSW 9 86790153 splice site probably null
R6029:Snap91 UTSW 9 86825080 splice site probably null
R6091:Snap91 UTSW 9 86839628 missense probably damaging 1.00
R6175:Snap91 UTSW 9 86825000 missense probably damaging 1.00
R6191:Snap91 UTSW 9 86838052 missense probably damaging 1.00
R6611:Snap91 UTSW 9 86790127 missense probably benign 0.33
R6881:Snap91 UTSW 9 86773593 missense possibly damaging 0.73
R7201:Snap91 UTSW 9 86790146 splice site probably null
R7223:Snap91 UTSW 9 86879557 start gained probably benign
R7247:Snap91 UTSW 9 86792616 missense unknown
R7327:Snap91 UTSW 9 86773545 missense unknown
X0027:Snap91 UTSW 9 86798828 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCACTCACCAGATAAGAGGTC -3'
(R):5'- TTGCTACTTAACCCAGAGTTCTTG -3'

Sequencing Primer
(F):5'- AGAACTCTCAGGCACCGGAG -3'
(R):5'- ACCCAGAGTTCTTGTGAATGC -3'
Posted On2018-08-29