Incidental Mutation 'R6764:Aff4'
ID531827
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene NameAF4/FMR2 family, member 4
SynonymsLaf4l, Alf4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6764 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location53350833-53421830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53399830 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 539 (R539L)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
Predicted Effect probably damaging
Transcript: ENSMUST00000060945
AA Change: R539L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: R539L

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152616
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A G 19: 5,502,872 S294P probably damaging Het
Aox2 T A 1: 58,350,282 Y1147N probably damaging Het
Arhgef25 A G 10: 127,184,101 F423L probably damaging Het
Atp1a2 A T 1: 172,284,614 D571E probably benign Het
Bank1 A G 3: 136,242,940 S159P probably damaging Het
Bcan C A 3: 87,988,378 R817L probably damaging Het
Cacna1g A G 11: 94,413,188 S1990P possibly damaging Het
Ccna1 G A 3: 55,046,078 T368M probably damaging Het
Chia1 T C 3: 106,130,740 probably null Het
Ctbp1 T C 5: 33,259,245 H136R possibly damaging Het
Dner T G 1: 84,494,781 D366A probably damaging Het
Eif3d A T 15: 77,961,686 D378E probably damaging Het
Evpl A G 11: 116,222,944 S1307P probably damaging Het
Fgd5 T A 6: 91,989,421 N720K probably damaging Het
Fmn1 A G 2: 113,525,215 E667G unknown Het
Gm4846 A G 1: 166,491,552 C206R probably benign Het
Grpel1 G A 5: 36,465,225 R11H probably benign Het
Gsn A G 2: 35,284,044 Y55C probably damaging Het
Hephl1 G A 9: 15,088,921 T345I possibly damaging Het
Ints2 T A 11: 86,212,779 K1150N probably benign Het
Itga4 C A 2: 79,325,614 H975N probably benign Het
Musk T C 4: 58,354,027 V360A probably damaging Het
Naalad2 A T 9: 18,402,889 probably benign Het
Ninj2 G T 6: 120,198,050 A51S probably benign Het
Pcdhac1 T C 18: 37,090,679 Y182H probably damaging Het
Pitpnm3 A G 11: 72,051,233 F916S probably damaging Het
Sfrp5 T A 19: 42,199,799 M194L probably benign Het
Sigirr C T 7: 141,093,242 V99I probably benign Het
Smco2 A G 6: 146,871,329 D343G probably damaging Het
Snap91 A G 9: 86,792,181 I584T probably benign Het
Syne1 G A 10: 5,229,011 Q4488* probably null Het
Tbc1d24 A C 17: 24,185,780 F130C possibly damaging Het
Trpm7 A G 2: 126,844,420 V296A possibly damaging Het
Ttll11 T C 2: 35,890,448 probably null Het
Vmn2r115 A G 17: 23,346,072 D311G probably damaging Het
Vmn2r63 A G 7: 42,903,271 S854P probably damaging Het
Zfp330 C T 8: 82,767,305 C109Y probably damaging Het
Zfp534 C T 4: 147,674,718 G498D probably benign Het
Zfp62 A G 11: 49,215,169 D29G probably damaging Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTTCCTCTGTAGACAGC -3'
(R):5'- GGTCGAGGAGAAGATTTTGATTCC -3'

Sequencing Primer
(F):5'- GCTTCCTCTGTAGACAGCAACATC -3'
(R):5'- ATGTTGGGTTTCCTCGAGCCC -3'
Posted On2018-08-29