Incidental Mutation 'R6765:Psmd5'
ID531843
Institutional Source Beutler Lab
Gene Symbol Psmd5
Ensembl Gene ENSMUSG00000026869
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 5
Synonyms1500032A03Rik, S5b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6765 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location34849734-34874968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 34856533 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 344 (M344R)
Ref Sequence ENSEMBL: ENSMUSP00000028225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028225]
Predicted Effect probably benign
Transcript: ENSMUST00000028225
AA Change: M344R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028225
Gene: ENSMUSG00000026869
AA Change: M344R

DomainStartEndE-ValueType
Pfam:Proteasom_PSMB 1 504 3.8e-199 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135575
AA Change: M26R
SMART Domains Protein: ENSMUSP00000116880
Gene: ENSMUSG00000026869
AA Change: M26R

DomainStartEndE-ValueType
Pfam:Proteasom_PSMB 1 56 1.4e-17 PFAM
Pfam:Proteasom_PSMB 51 140 1.5e-34 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a non-ATPase subunit of the 19S regulator base that functions as a chaperone protein during 26S proteasome assembly. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,686,429 G42W probably damaging Het
3110002H16Rik A G 18: 12,176,146 N92D possibly damaging Het
Adamtsl3 C A 7: 82,567,024 D878E possibly damaging Het
Adipor2 A C 6: 119,357,242 F336V possibly damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aoc1 A G 6: 48,905,937 N249S probably benign Het
Ap1b1 T A 11: 5,019,427 L261Q probably damaging Het
Ap3b1 T A 13: 94,462,509 D530E probably benign Het
Arid4b T A 13: 14,187,315 M788K possibly damaging Het
Atp2c2 A T 8: 119,753,017 I762F probably damaging Het
Bhlhe23 C A 2: 180,776,343 R134L probably damaging Het
Cacna2d3 T C 14: 29,055,977 D687G probably damaging Het
Ccdc136 G A 6: 29,405,941 M95I probably benign Het
Cdk12 T A 11: 98,224,529 I832N unknown Het
Clcn2 A C 16: 20,707,668 probably null Het
Csrnp2 C T 15: 100,482,693 R239Q probably damaging Het
Dhrs13 T A 11: 78,037,139 D270E probably benign Het
Dlgap2 G A 8: 14,743,284 G426D probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam120a A G 13: 48,891,964 Y799H probably damaging Het
Fam160b1 A G 19: 57,378,745 D240G probably benign Het
Farp1 G A 14: 121,222,654 V112I probably benign Het
Fsip2 A G 2: 82,986,432 I4170V probably benign Het
Gm12185 A G 11: 48,915,704 V220A probably benign Het
Gpr37l1 T C 1: 135,167,122 Y128C probably damaging Het
Gsto2 A T 19: 47,871,788 R7* probably null Het
Itih3 C T 14: 30,909,473 G822D probably benign Het
Kcnu1 A T 8: 25,913,645 D728V probably damaging Het
Lnpep G A 17: 17,530,496 T976I probably damaging Het
Map1b A C 13: 99,425,941 H2420Q unknown Het
Mc1r A G 8: 123,407,696 K63E probably damaging Het
Mpped1 G A 15: 83,836,383 V15M probably damaging Het
Ncor1 T C 11: 62,373,446 T103A probably benign Het
Nhsl1 A T 10: 18,531,314 T1399S probably benign Het
Nlrc5 C T 8: 94,490,368 T995M probably benign Het
Nrbp1 G A 5: 31,245,846 probably null Het
Olfr1065 T C 2: 86,445,236 T249A probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr979 A C 9: 40,001,197 F10C probably damaging Het
Pcdhb13 T C 18: 37,443,610 L347P probably damaging Het
Pkhd1 T C 1: 20,058,339 T4047A probably benign Het
Prrt2 T A 7: 127,019,597 D232V probably damaging Het
Pwp1 G A 10: 85,884,533 E345K probably damaging Het
Qsox1 A G 1: 155,791,105 Y213H probably benign Het
Sclt1 T C 3: 41,730,902 R39G unknown Het
Syne1 A T 10: 5,143,285 probably null Het
Tmem163 G T 1: 127,551,341 A147E probably damaging Het
Trav13n-4 A T 14: 53,364,100 M109L probably benign Het
Trp53bp1 T C 2: 121,209,309 E1283G probably damaging Het
Trpm6 T A 19: 18,877,765 D1929E probably damaging Het
Upb1 A T 10: 75,438,144 D335V probably damaging Het
Vps26b T C 9: 27,012,808 E213G probably damaging Het
Vwc2 C T 11: 11,154,215 T249I probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zan A G 5: 137,393,147 C4692R unknown Het
Zfp106 T C 2: 120,539,454 E29G probably damaging Het
Zfp551 G A 7: 12,416,840 A214V possibly damaging Het
Zfp981 T A 4: 146,537,906 H429Q probably benign Het
Other mutations in Psmd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01815:Psmd5 APN 2 34852771 missense probably benign 0.05
IGL01929:Psmd5 APN 2 34863466 missense probably damaging 0.96
IGL02019:Psmd5 APN 2 34854274 missense probably benign 0.16
IGL02291:Psmd5 APN 2 34857799 missense probably benign
IGL02402:Psmd5 APN 2 34857772 missense probably damaging 0.98
R1597:Psmd5 UTSW 2 34867023 missense probably damaging 0.97
R1820:Psmd5 UTSW 2 34870746 splice site probably null
R4855:Psmd5 UTSW 2 34852552 utr 3 prime probably benign
R4948:Psmd5 UTSW 2 34870783 missense probably benign 0.00
R5019:Psmd5 UTSW 2 34865953 intron probably benign
R5633:Psmd5 UTSW 2 34856488 missense probably benign 0.00
R6208:Psmd5 UTSW 2 34867011 missense probably damaging 1.00
R6787:Psmd5 UTSW 2 34857637 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTTTCATGTCCCAGTAACATAGTG -3'
(R):5'- TTCTAAGCATAACAAGTGTTCAGATG -3'

Sequencing Primer
(F):5'- CTGGCATTGAACTCAAGAGTACCTG -3'
(R):5'- ACCCCATAATGTACGTGGTG -3'
Posted On2018-08-29