Incidental Mutation 'R6765:Zfp106'
ID531847
Institutional Source Beutler Lab
Gene Symbol Zfp106
Ensembl Gene ENSMUSG00000027288
Gene Namezinc finger protein 106
SynonymsCd-1, H3a, Sh3bp3, sirm
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.562) question?
Stock #R6765 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120506820-120563843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120539454 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 29 (E29G)
Ref Sequence ENSEMBL: ENSMUSP00000128995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000135625] [ENSMUST00000171215]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055241
AA Change: E52G

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: E52G

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
ZnF_C2H2 43 67 7.18e1 SMART
low complexity region 75 92 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 199 212 N/A INTRINSIC
low complexity region 466 480 N/A INTRINSIC
coiled coil region 800 823 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
low complexity region 1312 1321 N/A INTRINSIC
low complexity region 1361 1373 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
WD40 1525 1562 9.24e-4 SMART
WD40 1565 1607 1.83e-7 SMART
PQQ 1587 1618 3.42e2 SMART
WD40 1651 1691 3.45e-1 SMART
PQQ 1671 1702 9.14e1 SMART
WD40 1694 1731 2.12e-3 SMART
PQQ 1711 1742 6.42e0 SMART
WD40 1734 1771 6e-3 SMART
PQQ 1751 1782 5.7e2 SMART
WD40 1774 1811 3.58e-1 SMART
ZnF_C2H2 1818 1843 5.34e-1 SMART
ZnF_C2H2 1851 1879 1.31e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135625
SMART Domains Protein: ENSMUSP00000126939
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167241
SMART Domains Protein: ENSMUSP00000127803
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 4 28 1.51e0 SMART
low complexity region 74 85 N/A INTRINSIC
low complexity region 132 145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171215
AA Change: E29G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: E29G

DomainStartEndE-ValueType
ZnF_C2H2 20 44 7.18e1 SMART
low complexity region 52 69 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 176 189 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
coiled coil region 777 800 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1289 1298 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1366 1386 N/A INTRINSIC
WD40 1502 1539 9.24e-4 SMART
WD40 1542 1584 1.83e-7 SMART
PQQ 1564 1595 3.42e2 SMART
WD40 1628 1668 3.45e-1 SMART
PQQ 1648 1679 9.14e1 SMART
WD40 1671 1708 2.12e-3 SMART
PQQ 1688 1719 6.42e0 SMART
WD40 1711 1748 6e-3 SMART
PQQ 1728 1759 5.7e2 SMART
WD40 1751 1788 3.58e-1 SMART
ZnF_C2H2 1795 1820 5.34e-1 SMART
ZnF_C2H2 1828 1856 1.31e2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,686,429 G42W probably damaging Het
3110002H16Rik A G 18: 12,176,146 N92D possibly damaging Het
Adamtsl3 C A 7: 82,567,024 D878E possibly damaging Het
Adipor2 A C 6: 119,357,242 F336V possibly damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aoc1 A G 6: 48,905,937 N249S probably benign Het
Ap1b1 T A 11: 5,019,427 L261Q probably damaging Het
Ap3b1 T A 13: 94,462,509 D530E probably benign Het
Arid4b T A 13: 14,187,315 M788K possibly damaging Het
Atp2c2 A T 8: 119,753,017 I762F probably damaging Het
Bhlhe23 C A 2: 180,776,343 R134L probably damaging Het
Cacna2d3 T C 14: 29,055,977 D687G probably damaging Het
Ccdc136 G A 6: 29,405,941 M95I probably benign Het
Cdk12 T A 11: 98,224,529 I832N unknown Het
Clcn2 A C 16: 20,707,668 probably null Het
Csrnp2 C T 15: 100,482,693 R239Q probably damaging Het
Dhrs13 T A 11: 78,037,139 D270E probably benign Het
Dlgap2 G A 8: 14,743,284 G426D probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam120a A G 13: 48,891,964 Y799H probably damaging Het
Fam160b1 A G 19: 57,378,745 D240G probably benign Het
Farp1 G A 14: 121,222,654 V112I probably benign Het
Fsip2 A G 2: 82,986,432 I4170V probably benign Het
Gm12185 A G 11: 48,915,704 V220A probably benign Het
Gpr37l1 T C 1: 135,167,122 Y128C probably damaging Het
Gsto2 A T 19: 47,871,788 R7* probably null Het
Itih3 C T 14: 30,909,473 G822D probably benign Het
Kcnu1 A T 8: 25,913,645 D728V probably damaging Het
Lnpep G A 17: 17,530,496 T976I probably damaging Het
Map1b A C 13: 99,425,941 H2420Q unknown Het
Mc1r A G 8: 123,407,696 K63E probably damaging Het
Mpped1 G A 15: 83,836,383 V15M probably damaging Het
Ncor1 T C 11: 62,373,446 T103A probably benign Het
Nhsl1 A T 10: 18,531,314 T1399S probably benign Het
Nlrc5 C T 8: 94,490,368 T995M probably benign Het
Nrbp1 G A 5: 31,245,846 probably null Het
Olfr1065 T C 2: 86,445,236 T249A probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr979 A C 9: 40,001,197 F10C probably damaging Het
Pcdhb13 T C 18: 37,443,610 L347P probably damaging Het
Pkhd1 T C 1: 20,058,339 T4047A probably benign Het
Prrt2 T A 7: 127,019,597 D232V probably damaging Het
Psmd5 A C 2: 34,856,533 M344R probably benign Het
Pwp1 G A 10: 85,884,533 E345K probably damaging Het
Qsox1 A G 1: 155,791,105 Y213H probably benign Het
Sclt1 T C 3: 41,730,902 R39G unknown Het
Syne1 A T 10: 5,143,285 probably null Het
Tmem163 G T 1: 127,551,341 A147E probably damaging Het
Trav13n-4 A T 14: 53,364,100 M109L probably benign Het
Trp53bp1 T C 2: 121,209,309 E1283G probably damaging Het
Trpm6 T A 19: 18,877,765 D1929E probably damaging Het
Upb1 A T 10: 75,438,144 D335V probably damaging Het
Vps26b T C 9: 27,012,808 E213G probably damaging Het
Vwc2 C T 11: 11,154,215 T249I probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zan A G 5: 137,393,147 C4692R unknown Het
Zfp551 G A 7: 12,416,840 A214V possibly damaging Het
Zfp981 T A 4: 146,537,906 H429Q probably benign Het
Other mutations in Zfp106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Zfp106 APN 2 120539497 missense probably benign 0.45
IGL00816:Zfp106 APN 2 120526848 missense probably benign 0.02
IGL00822:Zfp106 APN 2 120514160 missense probably damaging 1.00
IGL00848:Zfp106 APN 2 120512727 missense probably damaging 1.00
IGL01293:Zfp106 APN 2 120535035 missense possibly damaging 0.92
IGL01323:Zfp106 APN 2 120524464 missense possibly damaging 0.74
IGL01662:Zfp106 APN 2 120523553 missense probably benign 0.17
IGL01683:Zfp106 APN 2 120524555 missense probably benign 0.00
IGL01809:Zfp106 APN 2 120533671 missense probably damaging 1.00
IGL01958:Zfp106 APN 2 120534807 missense probably benign 0.26
IGL01960:Zfp106 APN 2 120524043 missense probably damaging 0.99
IGL01960:Zfp106 APN 2 120539322 missense probably benign 0.08
IGL02168:Zfp106 APN 2 120534231 missense possibly damaging 0.90
IGL02623:Zfp106 APN 2 120545914 splice site probably null
IGL02798:Zfp106 APN 2 120510510 missense probably damaging 1.00
IGL02828:Zfp106 APN 2 120531697 missense possibly damaging 0.86
IGL03022:Zfp106 APN 2 120528639 splice site probably benign
IGL03308:Zfp106 APN 2 120524024 missense probably benign 0.00
IGL03324:Zfp106 APN 2 120535387 missense probably benign 0.01
lepton UTSW 2 120532104 missense probably damaging 0.98
quark UTSW 2 120535060 nonsense probably null
string UTSW 2 120533594 missense probably damaging 0.96
theory UTSW 2 120533677 nonsense probably null
R0040:Zfp106 UTSW 2 120531613 missense probably damaging 1.00
R0040:Zfp106 UTSW 2 120531613 missense probably damaging 1.00
R0135:Zfp106 UTSW 2 120520487 missense probably damaging 0.99
R0180:Zfp106 UTSW 2 120533875 missense probably damaging 0.96
R0387:Zfp106 UTSW 2 120528472 splice site probably null
R0558:Zfp106 UTSW 2 120532196 missense probably damaging 1.00
R0680:Zfp106 UTSW 2 120527016 missense probably damaging 1.00
R0729:Zfp106 UTSW 2 120555248 missense probably damaging 0.99
R0828:Zfp106 UTSW 2 120535603 missense probably benign 0.00
R1124:Zfp106 UTSW 2 120534714 missense probably benign 0.00
R1147:Zfp106 UTSW 2 120520536 missense probably damaging 1.00
R1147:Zfp106 UTSW 2 120520536 missense probably damaging 1.00
R1226:Zfp106 UTSW 2 120524079 missense probably damaging 1.00
R1239:Zfp106 UTSW 2 120533594 missense probably damaging 0.96
R1634:Zfp106 UTSW 2 120533677 nonsense probably null
R1754:Zfp106 UTSW 2 120533763 missense probably damaging 0.96
R1754:Zfp106 UTSW 2 120533764 missense probably damaging 0.98
R1755:Zfp106 UTSW 2 120535175 missense probably damaging 1.00
R1763:Zfp106 UTSW 2 120520428 missense probably benign 0.03
R1875:Zfp106 UTSW 2 120513615 critical splice donor site probably null
R1903:Zfp106 UTSW 2 120526848 missense probably benign 0.02
R1932:Zfp106 UTSW 2 120531681 missense possibly damaging 0.80
R2070:Zfp106 UTSW 2 120523529 missense probably benign 0.11
R2301:Zfp106 UTSW 2 120535650 missense probably benign 0.04
R3429:Zfp106 UTSW 2 120527063 missense probably benign 0.00
R3720:Zfp106 UTSW 2 120534599 missense probably benign 0.01
R3875:Zfp106 UTSW 2 120534613 missense probably benign 0.08
R3881:Zfp106 UTSW 2 120532149 missense probably benign 0.01
R3921:Zfp106 UTSW 2 120533616 missense probably damaging 1.00
R3923:Zfp106 UTSW 2 120534856 missense probably damaging 0.99
R4087:Zfp106 UTSW 2 120526899 unclassified probably null
R4678:Zfp106 UTSW 2 120533740 missense probably damaging 1.00
R4965:Zfp106 UTSW 2 120533919 missense probably damaging 0.98
R5011:Zfp106 UTSW 2 120510534 missense probably damaging 1.00
R5013:Zfp106 UTSW 2 120510534 missense probably damaging 1.00
R5151:Zfp106 UTSW 2 120534727 missense probably benign 0.01
R5227:Zfp106 UTSW 2 120523968 missense probably benign 0.11
R5328:Zfp106 UTSW 2 120520417 missense possibly damaging 0.73
R5403:Zfp106 UTSW 2 120534781 missense probably benign 0.02
R5624:Zfp106 UTSW 2 120531957 missense probably damaging 0.99
R5686:Zfp106 UTSW 2 120533507 unclassified probably null
R5691:Zfp106 UTSW 2 120524471 missense probably damaging 0.99
R5852:Zfp106 UTSW 2 120516006 missense probably damaging 1.00
R6032:Zfp106 UTSW 2 120535393 missense probably benign 0.00
R6032:Zfp106 UTSW 2 120535393 missense probably benign 0.00
R6298:Zfp106 UTSW 2 120522704 missense probably damaging 1.00
R6409:Zfp106 UTSW 2 120532104 missense probably damaging 0.98
R6505:Zfp106 UTSW 2 120534502 missense probably damaging 0.99
R6598:Zfp106 UTSW 2 120535060 nonsense probably null
R7013:Zfp106 UTSW 2 120531632 missense probably damaging 0.99
X0025:Zfp106 UTSW 2 120534816 missense probably benign
Z1088:Zfp106 UTSW 2 120530490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGACAGAGAAGTTGTCTACATC -3'
(R):5'- AGGAGCACCGACTTGATTCC -3'

Sequencing Primer
(F):5'- AAACTAAAAACAAACCAACTTACCG -3'
(R):5'- AGCACCGACTTGATTCCCTCTAAC -3'
Posted On2018-08-29