Incidental Mutation 'R6765:Prrt2'
ID531859
Institutional Source Beutler Lab
Gene Symbol Prrt2
Ensembl Gene ENSMUSG00000045114
Gene Nameproline-rich transmembrane protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6765 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127017531-127021211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127019597 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 232 (D232V)
Ref Sequence ENSEMBL: ENSMUSP00000124520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032916] [ENSMUST00000159916] [ENSMUST00000161931] [ENSMUST00000162069] [ENSMUST00000165096] [ENSMUST00000200948] [ENSMUST00000202045] [ENSMUST00000202624] [ENSMUST00000202798] [ENSMUST00000205461] [ENSMUST00000205568] [ENSMUST00000206254] [ENSMUST00000206416]
Predicted Effect probably benign
Transcript: ENSMUST00000032916
SMART Domains Protein: ENSMUSP00000032916
Gene: ENSMUSG00000030678

DomainStartEndE-ValueType
low complexity region 59 82 N/A INTRINSIC
low complexity region 90 126 N/A INTRINSIC
low complexity region 130 179 N/A INTRINSIC
ZnF_C2H2 190 212 4.11e-2 SMART
low complexity region 231 272 N/A INTRINSIC
ZnF_C2H2 279 301 6.78e-3 SMART
ZnF_C2H2 307 329 4.87e-4 SMART
ZnF_C2H2 337 360 1.22e-4 SMART
ZnF_C2H2 366 388 1.79e-2 SMART
ZnF_C2H2 392 413 6.57e0 SMART
low complexity region 435 451 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159916
AA Change: D232V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124520
Gene: ENSMUSG00000045114
AA Change: D232V

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
low complexity region 146 169 N/A INTRINSIC
Pfam:CD225 263 337 3.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161931
SMART Domains Protein: ENSMUSP00000143833
Gene: ENSMUSG00000045114

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162069
SMART Domains Protein: ENSMUSP00000123889
Gene: ENSMUSG00000030680

DomainStartEndE-ValueType
Pfam:PAXIP1_C 1 55 2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165096
SMART Domains Protein: ENSMUSP00000127250
Gene: ENSMUSG00000030681

DomainStartEndE-ValueType
Pfam:Vault 122 163 5.4e-18 PFAM
Pfam:Vault 175 215 7.7e-16 PFAM
Pfam:Vault 228 271 7.9e-14 PFAM
Pfam:Vault 333 377 2.8e-16 PFAM
Pfam:MVP_shoulder 528 656 5.9e-55 PFAM
low complexity region 707 720 N/A INTRINSIC
low complexity region 733 749 N/A INTRINSIC
low complexity region 751 761 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172958
SMART Domains Protein: ENSMUSP00000134420
Gene: ENSMUSG00000092534

DomainStartEndE-ValueType
Pfam:PAXIP1_C 1 72 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200948
SMART Domains Protein: ENSMUSP00000144469
Gene: ENSMUSG00000030680

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 217 7.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201686
Predicted Effect probably benign
Transcript: ENSMUST00000202045
SMART Domains Protein: ENSMUSP00000144042
Gene: ENSMUSG00000045114

DomainStartEndE-ValueType
Pfam:CD225 1 52 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202624
SMART Domains Protein: ENSMUSP00000144099
Gene: ENSMUSG00000107068

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 176 5.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202798
SMART Domains Protein: ENSMUSP00000144243
Gene: ENSMUSG00000107068

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 217 7.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205461
Predicted Effect probably benign
Transcript: ENSMUST00000205568
Predicted Effect probably benign
Transcript: ENSMUST00000206254
Predicted Effect probably benign
Transcript: ENSMUST00000206416
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing a proline-rich domain in its N-terminal half. Studies in mice suggest that it is predominantly expressed in brain and spinal cord in embryonic and postnatal stages. Mutations in this gene are associated with episodic kinesigenic dyskinesia-1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele develop paroxysmal movements (bouncing and back walking) at the onset of locomotion and exhibit wild running and jumping in response to audiogenic stimuli and an increased sensitivity to the convulsive effects of pentylentetrazol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,686,429 G42W probably damaging Het
3110002H16Rik A G 18: 12,176,146 N92D possibly damaging Het
Adamtsl3 C A 7: 82,567,024 D878E possibly damaging Het
Adipor2 A C 6: 119,357,242 F336V possibly damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aoc1 A G 6: 48,905,937 N249S probably benign Het
Ap1b1 T A 11: 5,019,427 L261Q probably damaging Het
Ap3b1 T A 13: 94,462,509 D530E probably benign Het
Arid4b T A 13: 14,187,315 M788K possibly damaging Het
Atp2c2 A T 8: 119,753,017 I762F probably damaging Het
Bhlhe23 C A 2: 180,776,343 R134L probably damaging Het
Cacna2d3 T C 14: 29,055,977 D687G probably damaging Het
Ccdc136 G A 6: 29,405,941 M95I probably benign Het
Cdk12 T A 11: 98,224,529 I832N unknown Het
Clcn2 A C 16: 20,707,668 probably null Het
Csrnp2 C T 15: 100,482,693 R239Q probably damaging Het
Dhrs13 T A 11: 78,037,139 D270E probably benign Het
Dlgap2 G A 8: 14,743,284 G426D probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam120a A G 13: 48,891,964 Y799H probably damaging Het
Fam160b1 A G 19: 57,378,745 D240G probably benign Het
Farp1 G A 14: 121,222,654 V112I probably benign Het
Fsip2 A G 2: 82,986,432 I4170V probably benign Het
Gm12185 A G 11: 48,915,704 V220A probably benign Het
Gpr37l1 T C 1: 135,167,122 Y128C probably damaging Het
Gsto2 A T 19: 47,871,788 R7* probably null Het
Itih3 C T 14: 30,909,473 G822D probably benign Het
Kcnu1 A T 8: 25,913,645 D728V probably damaging Het
Lnpep G A 17: 17,530,496 T976I probably damaging Het
Map1b A C 13: 99,425,941 H2420Q unknown Het
Mc1r A G 8: 123,407,696 K63E probably damaging Het
Mpped1 G A 15: 83,836,383 V15M probably damaging Het
Ncor1 T C 11: 62,373,446 T103A probably benign Het
Nhsl1 A T 10: 18,531,314 T1399S probably benign Het
Nlrc5 C T 8: 94,490,368 T995M probably benign Het
Nrbp1 G A 5: 31,245,846 probably null Het
Olfr1065 T C 2: 86,445,236 T249A probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr979 A C 9: 40,001,197 F10C probably damaging Het
Pcdhb13 T C 18: 37,443,610 L347P probably damaging Het
Pkhd1 T C 1: 20,058,339 T4047A probably benign Het
Psmd5 A C 2: 34,856,533 M344R probably benign Het
Pwp1 G A 10: 85,884,533 E345K probably damaging Het
Qsox1 A G 1: 155,791,105 Y213H probably benign Het
Sclt1 T C 3: 41,730,902 R39G unknown Het
Syne1 A T 10: 5,143,285 probably null Het
Tmem163 G T 1: 127,551,341 A147E probably damaging Het
Trav13n-4 A T 14: 53,364,100 M109L probably benign Het
Trp53bp1 T C 2: 121,209,309 E1283G probably damaging Het
Trpm6 T A 19: 18,877,765 D1929E probably damaging Het
Upb1 A T 10: 75,438,144 D335V probably damaging Het
Vps26b T C 9: 27,012,808 E213G probably damaging Het
Vwc2 C T 11: 11,154,215 T249I probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zan A G 5: 137,393,147 C4692R unknown Het
Zfp106 T C 2: 120,539,454 E29G probably damaging Het
Zfp551 G A 7: 12,416,840 A214V possibly damaging Het
Zfp981 T A 4: 146,537,906 H429Q probably benign Het
Other mutations in Prrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1987:Prrt2 UTSW 7 127018730 missense probably benign 0.00
R2012:Prrt2 UTSW 7 127019409 missense probably damaging 1.00
R2504:Prrt2 UTSW 7 127020224 missense possibly damaging 0.84
R5622:Prrt2 UTSW 7 127019765 missense probably benign 0.02
R5655:Prrt2 UTSW 7 127019402 missense probably damaging 1.00
R5699:Prrt2 UTSW 7 127018727 missense probably benign 0.00
R5704:Prrt2 UTSW 7 127019418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCACAGTACACTTGGG -3'
(R):5'- CACAGAGGTCCTGACAGAAAGTAC -3'

Sequencing Primer
(F):5'- GCCACAATGTTGACAGGC -3'
(R):5'- TCCTGACAGAAAGTACAGGGG -3'
Posted On2018-08-29