Incidental Mutation 'R6765:Wwc2'
ID531862
Institutional Source Beutler Lab
Gene Symbol Wwc2
Ensembl Gene ENSMUSG00000031563
Gene NameWW, C2 and coiled-coil domain containing 2
SynonymsD8Ertd594e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6765 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location47823959-47990924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47900791 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 103 (Y103H)
Ref Sequence ENSEMBL: ENSMUSP00000056121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057561]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057561
AA Change: Y103H

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056121
Gene: ENSMUSG00000031563
AA Change: Y103H

DomainStartEndE-ValueType
WW 11 43 3.92e-11 SMART
WW 58 90 4.65e-4 SMART
low complexity region 143 156 N/A INTRINSIC
coiled coil region 162 194 N/A INTRINSIC
coiled coil region 223 254 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
coiled coil region 359 423 N/A INTRINSIC
low complexity region 540 567 N/A INTRINSIC
C2 713 818 5.29e0 SMART
coiled coil region 857 884 N/A INTRINSIC
coiled coil region 1067 1144 N/A INTRINSIC
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WW-and-C2-domain-containing family of proteins. Members of this family have two N-terminal WW domains that mediate binding to target proteins harboring L/PPxY motifs, an internal C2 domain for membrane association, and C-terminal alpha protein kinase C binding sites and class III PDZ domain-interaction motifs. Proteins of this family are able to form homo- and heterodimers and to modulate hippo pathway signaling. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,686,429 G42W probably damaging Het
3110002H16Rik A G 18: 12,176,146 N92D possibly damaging Het
Adamtsl3 C A 7: 82,567,024 D878E possibly damaging Het
Adipor2 A C 6: 119,357,242 F336V possibly damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aoc1 A G 6: 48,905,937 N249S probably benign Het
Ap1b1 T A 11: 5,019,427 L261Q probably damaging Het
Ap3b1 T A 13: 94,462,509 D530E probably benign Het
Arid4b T A 13: 14,187,315 M788K possibly damaging Het
Atp2c2 A T 8: 119,753,017 I762F probably damaging Het
Bhlhe23 C A 2: 180,776,343 R134L probably damaging Het
Cacna2d3 T C 14: 29,055,977 D687G probably damaging Het
Ccdc136 G A 6: 29,405,941 M95I probably benign Het
Cdk12 T A 11: 98,224,529 I832N unknown Het
Clcn2 A C 16: 20,707,668 probably null Het
Csrnp2 C T 15: 100,482,693 R239Q probably damaging Het
Dhrs13 T A 11: 78,037,139 D270E probably benign Het
Dlgap2 G A 8: 14,743,284 G426D probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam120a A G 13: 48,891,964 Y799H probably damaging Het
Fam160b1 A G 19: 57,378,745 D240G probably benign Het
Farp1 G A 14: 121,222,654 V112I probably benign Het
Fsip2 A G 2: 82,986,432 I4170V probably benign Het
Gm12185 A G 11: 48,915,704 V220A probably benign Het
Gpr37l1 T C 1: 135,167,122 Y128C probably damaging Het
Gsto2 A T 19: 47,871,788 R7* probably null Het
Itih3 C T 14: 30,909,473 G822D probably benign Het
Kcnu1 A T 8: 25,913,645 D728V probably damaging Het
Lnpep G A 17: 17,530,496 T976I probably damaging Het
Map1b A C 13: 99,425,941 H2420Q unknown Het
Mc1r A G 8: 123,407,696 K63E probably damaging Het
Mpped1 G A 15: 83,836,383 V15M probably damaging Het
Ncor1 T C 11: 62,373,446 T103A probably benign Het
Nhsl1 A T 10: 18,531,314 T1399S probably benign Het
Nlrc5 C T 8: 94,490,368 T995M probably benign Het
Nrbp1 G A 5: 31,245,846 probably null Het
Olfr1065 T C 2: 86,445,236 T249A probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr979 A C 9: 40,001,197 F10C probably damaging Het
Pcdhb13 T C 18: 37,443,610 L347P probably damaging Het
Pkhd1 T C 1: 20,058,339 T4047A probably benign Het
Prrt2 T A 7: 127,019,597 D232V probably damaging Het
Psmd5 A C 2: 34,856,533 M344R probably benign Het
Pwp1 G A 10: 85,884,533 E345K probably damaging Het
Qsox1 A G 1: 155,791,105 Y213H probably benign Het
Sclt1 T C 3: 41,730,902 R39G unknown Het
Syne1 A T 10: 5,143,285 probably null Het
Tmem163 G T 1: 127,551,341 A147E probably damaging Het
Trav13n-4 A T 14: 53,364,100 M109L probably benign Het
Trp53bp1 T C 2: 121,209,309 E1283G probably damaging Het
Trpm6 T A 19: 18,877,765 D1929E probably damaging Het
Upb1 A T 10: 75,438,144 D335V probably damaging Het
Vps26b T C 9: 27,012,808 E213G probably damaging Het
Vwc2 C T 11: 11,154,215 T249I probably benign Het
Zan A G 5: 137,393,147 C4692R unknown Het
Zfp106 T C 2: 120,539,454 E29G probably damaging Het
Zfp551 G A 7: 12,416,840 A214V possibly damaging Het
Zfp981 T A 4: 146,537,906 H429Q probably benign Het
Other mutations in Wwc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Wwc2 APN 8 47846158 missense unknown
IGL01397:Wwc2 APN 8 47868276 missense unknown
IGL01522:Wwc2 APN 8 47868633 missense unknown
IGL01530:Wwc2 APN 8 47863939 missense unknown
IGL01867:Wwc2 APN 8 47883580 missense probably benign 0.02
IGL01991:Wwc2 APN 8 47869866 nonsense probably null
IGL02092:Wwc2 APN 8 47864535 missense unknown
IGL02320:Wwc2 APN 8 47863847 splice site probably null
IGL02503:Wwc2 APN 8 47849383 missense unknown
H8562:Wwc2 UTSW 8 47920666 missense possibly damaging 0.77
R0244:Wwc2 UTSW 8 47900721 missense probably benign 0.16
R0331:Wwc2 UTSW 8 47880204 missense probably benign 0.15
R0349:Wwc2 UTSW 8 47868666 missense unknown
R0542:Wwc2 UTSW 8 47868379 missense unknown
R0645:Wwc2 UTSW 8 47900639 splice site probably benign
R1081:Wwc2 UTSW 8 47828764 unclassified probably benign
R1167:Wwc2 UTSW 8 47858779 nonsense probably null
R1646:Wwc2 UTSW 8 47842902 missense unknown
R1860:Wwc2 UTSW 8 47990102 missense possibly damaging 0.90
R2070:Wwc2 UTSW 8 47868321 missense unknown
R2183:Wwc2 UTSW 8 47842926 missense unknown
R3969:Wwc2 UTSW 8 47856323 missense unknown
R4096:Wwc2 UTSW 8 47842902 missense unknown
R4387:Wwc2 UTSW 8 47831646 missense unknown
R4447:Wwc2 UTSW 8 47868667 missense unknown
R4448:Wwc2 UTSW 8 47868667 missense unknown
R4450:Wwc2 UTSW 8 47868667 missense unknown
R4646:Wwc2 UTSW 8 47920601 missense probably damaging 1.00
R4869:Wwc2 UTSW 8 47920678 missense probably damaging 0.99
R5159:Wwc2 UTSW 8 47900761 missense probably benign 0.03
R5317:Wwc2 UTSW 8 47847555 missense unknown
R5391:Wwc2 UTSW 8 47863871 missense unknown
R5728:Wwc2 UTSW 8 47864061 missense unknown
R5871:Wwc2 UTSW 8 47868423 missense unknown
R5943:Wwc2 UTSW 8 47990102 missense possibly damaging 0.90
R6137:Wwc2 UTSW 8 47856263 missense unknown
R6169:Wwc2 UTSW 8 47858843 missense unknown
R6363:Wwc2 UTSW 8 47887162 splice site probably null
R6421:Wwc2 UTSW 8 47900746 missense probably damaging 1.00
R6467:Wwc2 UTSW 8 47851908 missense unknown
R6712:Wwc2 UTSW 8 47900803 missense probably benign 0.42
R6766:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6767:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6768:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6782:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6993:Wwc2 UTSW 8 47847465 missense unknown
R7016:Wwc2 UTSW 8 47847548 missense unknown
R7079:Wwc2 UTSW 8 47847545 missense unknown
R7219:Wwc2 UTSW 8 47858884 missense unknown
R7258:Wwc2 UTSW 8 47842999 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTCAAAATCTAACCACAGGAGTG -3'
(R):5'- TTAGGCGTTTCCAGCAGGTG -3'

Sequencing Primer
(F):5'- ACAGGAGTGTGAGTGACTGTCAC -3'
(R):5'- TGCTTTAGAGGACACAAGGATCCC -3'
Posted On2018-08-29