Incidental Mutation 'R6765:Nlrc5'
ID531863
Institutional Source Beutler Lab
Gene Symbol Nlrc5
Ensembl Gene ENSMUSG00000074151
Gene NameNLR family, CARD domain containing 5
SynonymsAI451557
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6765 (G1)
Quality Score204.009
Status Validated
Chromosome8
Chromosomal Location94434356-94527272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94490368 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 995 (T995M)
Ref Sequence ENSEMBL: ENSMUSP00000148677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053085] [ENSMUST00000182409] [ENSMUST00000211816]
Predicted Effect probably benign
Transcript: ENSMUST00000053085
AA Change: T995M

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138322
Gene: ENSMUSG00000074151
AA Change: T995M

DomainStartEndE-ValueType
low complexity region 136 151 N/A INTRINSIC
Pfam:NACHT 223 386 1.8e-32 PFAM
LRR 716 743 6.89e1 SMART
LRR 744 771 9.86e1 SMART
LRR 772 796 1.22e2 SMART
LRR 844 870 2.16e2 SMART
LRR 871 898 1.76e-1 SMART
LRR 1006 1033 1.9e0 SMART
LRR 1034 1061 4.51e1 SMART
low complexity region 1141 1169 N/A INTRINSIC
LRR 1240 1267 2.67e1 SMART
LRR 1273 1295 1.22e1 SMART
low complexity region 1341 1351 N/A INTRINSIC
LRR 1519 1546 5.48e1 SMART
LRR 1547 1574 3.36e1 SMART
LRR 1575 1602 1.69e1 SMART
LRR 1603 1630 8.99e-1 SMART
LRR 1631 1654 5.26e0 SMART
LRR 1659 1686 2.81e0 SMART
LRR 1687 1714 1.6e-4 SMART
LRR 1715 1742 1.06e0 SMART
LRR 1743 1768 8e0 SMART
LRR 1793 1820 2.06e1 SMART
LRR 1821 1848 5.42e-2 SMART
LRR 1849 1876 3.54e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182409
AA Change: T995M

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000183132
Predicted Effect probably benign
Transcript: ENSMUST00000211816
AA Change: T995M

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cytokine production induced by virus and bacteria infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,686,429 G42W probably damaging Het
3110002H16Rik A G 18: 12,176,146 N92D possibly damaging Het
Adamtsl3 C A 7: 82,567,024 D878E possibly damaging Het
Adipor2 A C 6: 119,357,242 F336V possibly damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aoc1 A G 6: 48,905,937 N249S probably benign Het
Ap1b1 T A 11: 5,019,427 L261Q probably damaging Het
Ap3b1 T A 13: 94,462,509 D530E probably benign Het
Arid4b T A 13: 14,187,315 M788K possibly damaging Het
Atp2c2 A T 8: 119,753,017 I762F probably damaging Het
Bhlhe23 C A 2: 180,776,343 R134L probably damaging Het
Cacna2d3 T C 14: 29,055,977 D687G probably damaging Het
Ccdc136 G A 6: 29,405,941 M95I probably benign Het
Cdk12 T A 11: 98,224,529 I832N unknown Het
Clcn2 A C 16: 20,707,668 probably null Het
Csrnp2 C T 15: 100,482,693 R239Q probably damaging Het
Dhrs13 T A 11: 78,037,139 D270E probably benign Het
Dlgap2 G A 8: 14,743,284 G426D probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam120a A G 13: 48,891,964 Y799H probably damaging Het
Fam160b1 A G 19: 57,378,745 D240G probably benign Het
Farp1 G A 14: 121,222,654 V112I probably benign Het
Fsip2 A G 2: 82,986,432 I4170V probably benign Het
Gm12185 A G 11: 48,915,704 V220A probably benign Het
Gpr37l1 T C 1: 135,167,122 Y128C probably damaging Het
Gsto2 A T 19: 47,871,788 R7* probably null Het
Itih3 C T 14: 30,909,473 G822D probably benign Het
Kcnu1 A T 8: 25,913,645 D728V probably damaging Het
Lnpep G A 17: 17,530,496 T976I probably damaging Het
Map1b A C 13: 99,425,941 H2420Q unknown Het
Mc1r A G 8: 123,407,696 K63E probably damaging Het
Mpped1 G A 15: 83,836,383 V15M probably damaging Het
Ncor1 T C 11: 62,373,446 T103A probably benign Het
Nhsl1 A T 10: 18,531,314 T1399S probably benign Het
Nrbp1 G A 5: 31,245,846 probably null Het
Olfr1065 T C 2: 86,445,236 T249A probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr979 A C 9: 40,001,197 F10C probably damaging Het
Pcdhb13 T C 18: 37,443,610 L347P probably damaging Het
Pkhd1 T C 1: 20,058,339 T4047A probably benign Het
Prrt2 T A 7: 127,019,597 D232V probably damaging Het
Psmd5 A C 2: 34,856,533 M344R probably benign Het
Pwp1 G A 10: 85,884,533 E345K probably damaging Het
Qsox1 A G 1: 155,791,105 Y213H probably benign Het
Sclt1 T C 3: 41,730,902 R39G unknown Het
Syne1 A T 10: 5,143,285 probably null Het
Tmem163 G T 1: 127,551,341 A147E probably damaging Het
Trav13n-4 A T 14: 53,364,100 M109L probably benign Het
Trp53bp1 T C 2: 121,209,309 E1283G probably damaging Het
Trpm6 T A 19: 18,877,765 D1929E probably damaging Het
Upb1 A T 10: 75,438,144 D335V probably damaging Het
Vps26b T C 9: 27,012,808 E213G probably damaging Het
Vwc2 C T 11: 11,154,215 T249I probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zan A G 5: 137,393,147 C4692R unknown Het
Zfp106 T C 2: 120,539,454 E29G probably damaging Het
Zfp551 G A 7: 12,416,840 A214V possibly damaging Het
Zfp981 T A 4: 146,537,906 H429Q probably benign Het
Other mutations in Nlrc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Nlrc5 APN 8 94502211 splice site probably benign
IGL00232:Nlrc5 APN 8 94484623 critical splice donor site probably null
IGL00324:Nlrc5 APN 8 94521479 missense probably damaging 1.00
IGL02715:Nlrc5 APN 8 94474668 missense probably damaging 1.00
IGL02992:Nlrc5 APN 8 94506573 missense possibly damaging 0.69
IGL03095:Nlrc5 APN 8 94521908 splice site probably benign
IGL03389:Nlrc5 APN 8 94521474 missense probably damaging 1.00
IGL03406:Nlrc5 APN 8 94476855 missense probably benign 0.01
cowberry UTSW 8 94491525 missense possibly damaging 0.83
lingon UTSW 8 94481860 missense probably damaging 1.00
R0037:Nlrc5 UTSW 8 94489535 missense probably benign 0.00
R0048:Nlrc5 UTSW 8 94474656 missense possibly damaging 0.81
R0092:Nlrc5 UTSW 8 94489594 splice site probably benign
R0506:Nlrc5 UTSW 8 94493125 splice site probably benign
R0548:Nlrc5 UTSW 8 94521783 missense probably null 0.09
R2014:Nlrc5 UTSW 8 94525510 splice site probably benign
R3051:Nlrc5 UTSW 8 94476715 missense probably benign 0.01
R3776:Nlrc5 UTSW 8 94472839 missense possibly damaging 0.48
R3837:Nlrc5 UTSW 8 94511301 splice site probably benign
R4012:Nlrc5 UTSW 8 94475992 missense possibly damaging 0.92
R4367:Nlrc5 UTSW 8 94476564 missense probably damaging 1.00
R4400:Nlrc5 UTSW 8 94494353 missense probably benign 0.08
R4469:Nlrc5 UTSW 8 94520839 missense probably damaging 1.00
R4561:Nlrc5 UTSW 8 94477146 missense probably damaging 1.00
R4584:Nlrc5 UTSW 8 94477275 missense probably damaging 0.96
R4758:Nlrc5 UTSW 8 94512328 missense possibly damaging 0.70
R4834:Nlrc5 UTSW 8 94505485 missense probably benign 0.00
R4896:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5004:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5018:Nlrc5 UTSW 8 94525452 missense probably damaging 1.00
R5115:Nlrc5 UTSW 8 94476819 missense possibly damaging 0.67
R5116:Nlrc5 UTSW 8 94481860 missense probably damaging 1.00
R5126:Nlrc5 UTSW 8 94474671 missense possibly damaging 0.95
R5148:Nlrc5 UTSW 8 94476693 missense probably damaging 1.00
R5224:Nlrc5 UTSW 8 94494316 missense probably benign 0.26
R5527:Nlrc5 UTSW 8 94490416 missense probably damaging 1.00
R5640:Nlrc5 UTSW 8 94475793 missense probably benign 0.02
R5705:Nlrc5 UTSW 8 94475757 missense probably benign 0.00
R5778:Nlrc5 UTSW 8 94479526 missense possibly damaging 0.66
R5830:Nlrc5 UTSW 8 94472914 missense probably damaging 1.00
R5850:Nlrc5 UTSW 8 94521047 missense probably benign 0.00
R5978:Nlrc5 UTSW 8 94488593 missense probably damaging 0.98
R6335:Nlrc5 UTSW 8 94502274 missense probably benign 0.01
R6372:Nlrc5 UTSW 8 94479750 missense probably damaging 0.98
R6486:Nlrc5 UTSW 8 94521299 splice site probably null
R6861:Nlrc5 UTSW 8 94521229 unclassified probably benign
R6869:Nlrc5 UTSW 8 94521955 missense probably benign 0.00
R7134:Nlrc5 UTSW 8 94479722 missense probably damaging 0.99
R7204:Nlrc5 UTSW 8 94491525 missense possibly damaging 0.83
R7231:Nlrc5 UTSW 8 94521805 critical splice donor site probably null
R7309:Nlrc5 UTSW 8 94474042 missense probably benign 0.01
R7368:Nlrc5 UTSW 8 94476393 nonsense probably null
Z1088:Nlrc5 UTSW 8 94504464 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTCTGCTATTTGGGGCATGC -3'
(R):5'- AGAAAGTCACTGTCCCTCCC -3'

Sequencing Primer
(F):5'- GCATGCTGTGTGTTAGTCCTCC -3'
(R):5'- CCAGGTCTCTGAAGGGTCTCTG -3'
Posted On2018-08-29