Incidental Mutation 'R6765:Mc1r'
ID531865
Institutional Source Beutler Lab
Gene Symbol Mc1r
Ensembl Gene ENSMUSG00000074037
Gene Namemelanocortin 1 receptor
Synonymsextension recessive yellow, e, Mshra
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6765 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location123407107-123410744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123407696 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 63 (K63E)
Ref Sequence ENSEMBL: ENSMUSP00000095929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071134] [ENSMUST00000098324] [ENSMUST00000108840] [ENSMUST00000127664] [ENSMUST00000211932] [ENSMUST00000212470] [ENSMUST00000212571] [ENSMUST00000212743] [ENSMUST00000212880]
Predicted Effect probably benign
Transcript: ENSMUST00000071134
SMART Domains Protein: ENSMUSP00000071134
Gene: ENSMUSG00000062380

DomainStartEndE-ValueType
Tubulin 47 244 8.63e-65 SMART
Tubulin_C 246 383 1.35e-48 SMART
low complexity region 427 446 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098324
AA Change: K63E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095929
Gene: ENSMUSG00000074037
AA Change: K63E

DomainStartEndE-ValueType
Pfam:7tm_4 43 188 1.3e-13 PFAM
Pfam:7TM_GPCR_Srsx 47 311 1e-7 PFAM
Pfam:7tm_1 53 296 2.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108840
SMART Domains Protein: ENSMUSP00000104468
Gene: ENSMUSG00000001472

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 247 588 2.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211932
Predicted Effect probably benign
Transcript: ENSMUST00000212470
Predicted Effect probably benign
Transcript: ENSMUST00000212571
Predicted Effect probably benign
Transcript: ENSMUST00000212743
Predicted Effect probably benign
Transcript: ENSMUST00000212880
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant alleles at this locus extend or restrict the amount of black pigment (eumelanin) in hair with the opposite effect on yellow pigment (phaeomelanin). Some variants affect pain sensitivity. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(2) Spontaneous(6) Chemically induced(2)
Mutant alleles at this locus extend or restrict the amount of black pigment (eumelanin) in hair with the opposite effect on yellow pigment (phaeomelanin). Some variants affect pain sensitivity.

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,686,429 G42W probably damaging Het
3110002H16Rik A G 18: 12,176,146 N92D possibly damaging Het
Adamtsl3 C A 7: 82,567,024 D878E possibly damaging Het
Adipor2 A C 6: 119,357,242 F336V possibly damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aoc1 A G 6: 48,905,937 N249S probably benign Het
Ap1b1 T A 11: 5,019,427 L261Q probably damaging Het
Ap3b1 T A 13: 94,462,509 D530E probably benign Het
Arid4b T A 13: 14,187,315 M788K possibly damaging Het
Atp2c2 A T 8: 119,753,017 I762F probably damaging Het
Bhlhe23 C A 2: 180,776,343 R134L probably damaging Het
Cacna2d3 T C 14: 29,055,977 D687G probably damaging Het
Ccdc136 G A 6: 29,405,941 M95I probably benign Het
Cdk12 T A 11: 98,224,529 I832N unknown Het
Clcn2 A C 16: 20,707,668 probably null Het
Csrnp2 C T 15: 100,482,693 R239Q probably damaging Het
Dhrs13 T A 11: 78,037,139 D270E probably benign Het
Dlgap2 G A 8: 14,743,284 G426D probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam120a A G 13: 48,891,964 Y799H probably damaging Het
Fam160b1 A G 19: 57,378,745 D240G probably benign Het
Farp1 G A 14: 121,222,654 V112I probably benign Het
Fsip2 A G 2: 82,986,432 I4170V probably benign Het
Gm12185 A G 11: 48,915,704 V220A probably benign Het
Gpr37l1 T C 1: 135,167,122 Y128C probably damaging Het
Gsto2 A T 19: 47,871,788 R7* probably null Het
Itih3 C T 14: 30,909,473 G822D probably benign Het
Kcnu1 A T 8: 25,913,645 D728V probably damaging Het
Lnpep G A 17: 17,530,496 T976I probably damaging Het
Map1b A C 13: 99,425,941 H2420Q unknown Het
Mpped1 G A 15: 83,836,383 V15M probably damaging Het
Ncor1 T C 11: 62,373,446 T103A probably benign Het
Nhsl1 A T 10: 18,531,314 T1399S probably benign Het
Nlrc5 C T 8: 94,490,368 T995M probably benign Het
Nrbp1 G A 5: 31,245,846 probably null Het
Olfr1065 T C 2: 86,445,236 T249A probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr979 A C 9: 40,001,197 F10C probably damaging Het
Pcdhb13 T C 18: 37,443,610 L347P probably damaging Het
Pkhd1 T C 1: 20,058,339 T4047A probably benign Het
Prrt2 T A 7: 127,019,597 D232V probably damaging Het
Psmd5 A C 2: 34,856,533 M344R probably benign Het
Pwp1 G A 10: 85,884,533 E345K probably damaging Het
Qsox1 A G 1: 155,791,105 Y213H probably benign Het
Sclt1 T C 3: 41,730,902 R39G unknown Het
Syne1 A T 10: 5,143,285 probably null Het
Tmem163 G T 1: 127,551,341 A147E probably damaging Het
Trav13n-4 A T 14: 53,364,100 M109L probably benign Het
Trp53bp1 T C 2: 121,209,309 E1283G probably damaging Het
Trpm6 T A 19: 18,877,765 D1929E probably damaging Het
Upb1 A T 10: 75,438,144 D335V probably damaging Het
Vps26b T C 9: 27,012,808 E213G probably damaging Het
Vwc2 C T 11: 11,154,215 T249I probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zan A G 5: 137,393,147 C4692R unknown Het
Zfp106 T C 2: 120,539,454 E29G probably damaging Het
Zfp551 G A 7: 12,416,840 A214V possibly damaging Het
Zfp981 T A 4: 146,537,906 H429Q probably benign Het
Other mutations in Mc1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Mc1r APN 8 123408050 missense probably damaging 1.00
IGL02878:Mc1r APN 8 123407630 missense probably damaging 1.00
deer UTSW 8 123407958 missense probably damaging 1.00
R1240:Mc1r UTSW 8 123408260 missense probably damaging 1.00
R1871:Mc1r UTSW 8 123407536 missense probably benign
R2071:Mc1r UTSW 8 123408369 missense possibly damaging 0.84
R4006:Mc1r UTSW 8 123407637 missense probably damaging 1.00
R4226:Mc1r UTSW 8 123407856 missense possibly damaging 0.88
R4865:Mc1r UTSW 8 123407516 missense probably benign 0.25
R6652:Mc1r UTSW 8 123407631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCCTACTTCCTGACAAGAC -3'
(R):5'- ACCATGGAGCCACAGATGAG -3'

Sequencing Primer
(F):5'- GACAAGACTATGTCCACTCAGG -3'
(R):5'- AGCACGTCAATGAGGTTGTCC -3'
Posted On2018-08-29