Incidental Mutation 'R6765:Olfr979'
ID531867
Institutional Source Beutler Lab
Gene Symbol Olfr979
Ensembl Gene ENSMUSG00000059473
Gene Nameolfactory receptor 979
SynonymsMOR223-1, GA_x6K02T2PVTD-33699706-33698771
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6765 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39998003-40003465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 40001197 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 10 (F10C)
Ref Sequence ENSEMBL: ENSMUSP00000148903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073932] [ENSMUST00000080835] [ENSMUST00000215523] [ENSMUST00000216463]
Predicted Effect probably benign
Transcript: ENSMUST00000073932
SMART Domains Protein: ENSMUSP00000091386
Gene: ENSMUSG00000060254

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.4e-55 PFAM
Pfam:7tm_1 39 287 5.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080835
AA Change: F10C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079648
Gene: ENSMUSG00000059473
AA Change: F10C

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 7.9e-58 PFAM
Pfam:7tm_1 39 287 5.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215523
AA Change: F10C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216463
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,686,429 G42W probably damaging Het
3110002H16Rik A G 18: 12,176,146 N92D possibly damaging Het
Adamtsl3 C A 7: 82,567,024 D878E possibly damaging Het
Adipor2 A C 6: 119,357,242 F336V possibly damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aoc1 A G 6: 48,905,937 N249S probably benign Het
Ap1b1 T A 11: 5,019,427 L261Q probably damaging Het
Ap3b1 T A 13: 94,462,509 D530E probably benign Het
Arid4b T A 13: 14,187,315 M788K possibly damaging Het
Atp2c2 A T 8: 119,753,017 I762F probably damaging Het
Bhlhe23 C A 2: 180,776,343 R134L probably damaging Het
Cacna2d3 T C 14: 29,055,977 D687G probably damaging Het
Ccdc136 G A 6: 29,405,941 M95I probably benign Het
Cdk12 T A 11: 98,224,529 I832N unknown Het
Clcn2 A C 16: 20,707,668 probably null Het
Csrnp2 C T 15: 100,482,693 R239Q probably damaging Het
Dhrs13 T A 11: 78,037,139 D270E probably benign Het
Dlgap2 G A 8: 14,743,284 G426D probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam120a A G 13: 48,891,964 Y799H probably damaging Het
Fam160b1 A G 19: 57,378,745 D240G probably benign Het
Farp1 G A 14: 121,222,654 V112I probably benign Het
Fsip2 A G 2: 82,986,432 I4170V probably benign Het
Gm12185 A G 11: 48,915,704 V220A probably benign Het
Gpr37l1 T C 1: 135,167,122 Y128C probably damaging Het
Gsto2 A T 19: 47,871,788 R7* probably null Het
Itih3 C T 14: 30,909,473 G822D probably benign Het
Kcnu1 A T 8: 25,913,645 D728V probably damaging Het
Lnpep G A 17: 17,530,496 T976I probably damaging Het
Map1b A C 13: 99,425,941 H2420Q unknown Het
Mc1r A G 8: 123,407,696 K63E probably damaging Het
Mpped1 G A 15: 83,836,383 V15M probably damaging Het
Ncor1 T C 11: 62,373,446 T103A probably benign Het
Nhsl1 A T 10: 18,531,314 T1399S probably benign Het
Nlrc5 C T 8: 94,490,368 T995M probably benign Het
Nrbp1 G A 5: 31,245,846 probably null Het
Olfr1065 T C 2: 86,445,236 T249A probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Pcdhb13 T C 18: 37,443,610 L347P probably damaging Het
Pkhd1 T C 1: 20,058,339 T4047A probably benign Het
Prrt2 T A 7: 127,019,597 D232V probably damaging Het
Psmd5 A C 2: 34,856,533 M344R probably benign Het
Pwp1 G A 10: 85,884,533 E345K probably damaging Het
Qsox1 A G 1: 155,791,105 Y213H probably benign Het
Sclt1 T C 3: 41,730,902 R39G unknown Het
Syne1 A T 10: 5,143,285 probably null Het
Tmem163 G T 1: 127,551,341 A147E probably damaging Het
Trav13n-4 A T 14: 53,364,100 M109L probably benign Het
Trp53bp1 T C 2: 121,209,309 E1283G probably damaging Het
Trpm6 T A 19: 18,877,765 D1929E probably damaging Het
Upb1 A T 10: 75,438,144 D335V probably damaging Het
Vps26b T C 9: 27,012,808 E213G probably damaging Het
Vwc2 C T 11: 11,154,215 T249I probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zan A G 5: 137,393,147 C4692R unknown Het
Zfp106 T C 2: 120,539,454 E29G probably damaging Het
Zfp551 G A 7: 12,416,840 A214V possibly damaging Het
Zfp981 T A 4: 146,537,906 H429Q probably benign Het
Other mutations in Olfr979
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Olfr979 APN 9 40000886 missense probably damaging 1.00
IGL02939:Olfr979 APN 9 40000898 missense probably benign 0.26
IGL02991:Olfr979 UTSW 9 40000402 missense probably damaging 1.00
R1388:Olfr979 UTSW 9 40000652 missense probably damaging 0.99
R1572:Olfr979 UTSW 9 40001194 missense probably benign 0.35
R2089:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2091:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2091:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2179:Olfr979 UTSW 9 40000924 missense probably benign 0.44
R3424:Olfr979 UTSW 9 40000534 missense probably damaging 0.97
R3964:Olfr979 UTSW 9 40000471 missense possibly damaging 0.95
R3965:Olfr979 UTSW 9 40000471 missense possibly damaging 0.95
R4111:Olfr979 UTSW 9 40000898 nonsense probably null
R4537:Olfr979 UTSW 9 40000320 missense probably benign 0.01
R4737:Olfr979 UTSW 9 40000422 missense probably damaging 0.96
R4926:Olfr979 UTSW 9 40001023 unclassified probably null
R5303:Olfr979 UTSW 9 40000588 missense probably damaging 1.00
R5587:Olfr979 UTSW 9 40000621 missense possibly damaging 0.90
R6387:Olfr979 UTSW 9 40000852 missense probably damaging 0.99
R6394:Olfr979 UTSW 9 40000705 missense probably benign 0.04
R7312:Olfr979 UTSW 9 40000810 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GGTACTGTGACTGTGGAGAACC -3'
(R):5'- CTGTGAGAATTCTTCGTGCTTC -3'

Sequencing Primer
(F):5'- CCACATATCAATAAAGGAGAGGTTG -3'
(R):5'- GTGAGAATTCTTCGTGCTTCTAAATC -3'
Posted On2018-08-29