Incidental Mutation 'R6765:Upb1'
ID531870
Institutional Source Beutler Lab
Gene Symbol Upb1
Ensembl Gene ENSMUSG00000033427
Gene Nameureidopropionase, beta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R6765 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location75401115-75441679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75438144 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 335 (D335V)
Ref Sequence ENSEMBL: ENSMUSP00000049342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039925] [ENSMUST00000145890]
Predicted Effect probably damaging
Transcript: ENSMUST00000039925
AA Change: D335V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049342
Gene: ENSMUSG00000033427
AA Change: D335V

DomainStartEndE-ValueType
Pfam:CN_hydrolase 73 352 8.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145890
SMART Domains Protein: ENSMUSP00000123254
Gene: ENSMUSG00000033416

DomainStartEndE-ValueType
Pfam:Peptidase_C39_2 20 206 2.6e-10 PFAM
Pfam:Guanylate_cyc_2 22 210 4e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153125
SMART Domains Protein: ENSMUSP00000117061
Gene: ENSMUSG00000033416

DomainStartEndE-ValueType
Pfam:Guanylate_cyc_2 2 91 2.3e-35 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes an enzyme that catalyzes the conversion of N-carbamyl-beta-aminoisobutyric acid and N-carbamyl-beta-alanine to beta-aminoisobutyric acid or beta-alanine. Mutations in the related gene in human have been associated with beta-ureidopropionase deficiency. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,686,429 G42W probably damaging Het
3110002H16Rik A G 18: 12,176,146 N92D possibly damaging Het
Adamtsl3 C A 7: 82,567,024 D878E possibly damaging Het
Adipor2 A C 6: 119,357,242 F336V possibly damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aoc1 A G 6: 48,905,937 N249S probably benign Het
Ap1b1 T A 11: 5,019,427 L261Q probably damaging Het
Ap3b1 T A 13: 94,462,509 D530E probably benign Het
Arid4b T A 13: 14,187,315 M788K possibly damaging Het
Atp2c2 A T 8: 119,753,017 I762F probably damaging Het
Bhlhe23 C A 2: 180,776,343 R134L probably damaging Het
Cacna2d3 T C 14: 29,055,977 D687G probably damaging Het
Ccdc136 G A 6: 29,405,941 M95I probably benign Het
Cdk12 T A 11: 98,224,529 I832N unknown Het
Clcn2 A C 16: 20,707,668 probably null Het
Csrnp2 C T 15: 100,482,693 R239Q probably damaging Het
Dhrs13 T A 11: 78,037,139 D270E probably benign Het
Dlgap2 G A 8: 14,743,284 G426D probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam120a A G 13: 48,891,964 Y799H probably damaging Het
Fam160b1 A G 19: 57,378,745 D240G probably benign Het
Farp1 G A 14: 121,222,654 V112I probably benign Het
Fsip2 A G 2: 82,986,432 I4170V probably benign Het
Gm12185 A G 11: 48,915,704 V220A probably benign Het
Gpr37l1 T C 1: 135,167,122 Y128C probably damaging Het
Gsto2 A T 19: 47,871,788 R7* probably null Het
Itih3 C T 14: 30,909,473 G822D probably benign Het
Kcnu1 A T 8: 25,913,645 D728V probably damaging Het
Lnpep G A 17: 17,530,496 T976I probably damaging Het
Map1b A C 13: 99,425,941 H2420Q unknown Het
Mc1r A G 8: 123,407,696 K63E probably damaging Het
Mpped1 G A 15: 83,836,383 V15M probably damaging Het
Ncor1 T C 11: 62,373,446 T103A probably benign Het
Nhsl1 A T 10: 18,531,314 T1399S probably benign Het
Nlrc5 C T 8: 94,490,368 T995M probably benign Het
Nrbp1 G A 5: 31,245,846 probably null Het
Olfr1065 T C 2: 86,445,236 T249A probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr979 A C 9: 40,001,197 F10C probably damaging Het
Pcdhb13 T C 18: 37,443,610 L347P probably damaging Het
Pkhd1 T C 1: 20,058,339 T4047A probably benign Het
Prrt2 T A 7: 127,019,597 D232V probably damaging Het
Psmd5 A C 2: 34,856,533 M344R probably benign Het
Pwp1 G A 10: 85,884,533 E345K probably damaging Het
Qsox1 A G 1: 155,791,105 Y213H probably benign Het
Sclt1 T C 3: 41,730,902 R39G unknown Het
Syne1 A T 10: 5,143,285 probably null Het
Tmem163 G T 1: 127,551,341 A147E probably damaging Het
Trav13n-4 A T 14: 53,364,100 M109L probably benign Het
Trp53bp1 T C 2: 121,209,309 E1283G probably damaging Het
Trpm6 T A 19: 18,877,765 D1929E probably damaging Het
Vps26b T C 9: 27,012,808 E213G probably damaging Het
Vwc2 C T 11: 11,154,215 T249I probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zan A G 5: 137,393,147 C4692R unknown Het
Zfp106 T C 2: 120,539,454 E29G probably damaging Het
Zfp551 G A 7: 12,416,840 A214V possibly damaging Het
Zfp981 T A 4: 146,537,906 H429Q probably benign Het
Other mutations in Upb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0419:Upb1 UTSW 10 75412883 missense probably damaging 1.00
R0450:Upb1 UTSW 10 75415083 splice site probably null
R0469:Upb1 UTSW 10 75415083 splice site probably null
R0565:Upb1 UTSW 10 75428354 unclassified probably benign
R1109:Upb1 UTSW 10 75438165 missense probably damaging 1.00
R1439:Upb1 UTSW 10 75439942 missense probably benign
R2001:Upb1 UTSW 10 75429969 missense probably damaging 1.00
R2074:Upb1 UTSW 10 75424513 missense probably damaging 1.00
R2254:Upb1 UTSW 10 75436217 missense probably damaging 1.00
R2255:Upb1 UTSW 10 75436217 missense probably damaging 1.00
R3773:Upb1 UTSW 10 75439838 intron probably null
R4696:Upb1 UTSW 10 75415027 missense probably benign 0.22
R5157:Upb1 UTSW 10 75412804 missense possibly damaging 0.78
R5723:Upb1 UTSW 10 75428271 missense probably damaging 0.99
R6292:Upb1 UTSW 10 75438171 missense probably damaging 1.00
R6335:Upb1 UTSW 10 75428301 missense probably benign 0.09
R6577:Upb1 UTSW 10 75412889 missense probably damaging 1.00
R6756:Upb1 UTSW 10 75428301 missense possibly damaging 0.78
R7069:Upb1 UTSW 10 75412768 missense probably benign 0.00
R7094:Upb1 UTSW 10 75438208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGACCTTTAGGCCTGAGG -3'
(R):5'- AGTTGGTGCCTTTCCCCAAC -3'

Sequencing Primer
(F):5'- GGTGGCCCTGAATGCTTTCC -3'
(R):5'- CAACTGCCTGCTGGAGC -3'
Posted On2018-08-29