Incidental Mutation 'R6767:Grid2'
ID531971
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Nameglutamate receptor, ionotropic, delta 2
SynonymsGluRdelta2, tpr, B230104L07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6767 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location63255876-64704323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63931015 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 213 (D213G)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
Predicted Effect probably benign
Transcript: ENSMUST00000095852
AA Change: D213G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: D213G

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Fasn T C 11: 120,817,487 I651V possibly damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64345589 missense probably damaging 1.00
IGL00596:Grid2 APN 6 64533704 missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64320196 missense probably benign 0.00
IGL01712:Grid2 APN 6 64665915 missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64063935 missense probably benign 0.29
IGL02216:Grid2 APN 6 64345666 missense probably damaging 0.96
IGL02563:Grid2 APN 6 64345873 missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64345816 missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64063904 missense probably damaging 0.98
IGL03324:Grid2 APN 6 64429822 missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63909069 missense possibly damaging 0.94
crawler UTSW 6 64429694 nonsense probably null
swagger UTSW 6 64395280 synonymous probably benign
R0133:Grid2 UTSW 6 64320132 missense probably damaging 1.00
R0147:Grid2 UTSW 6 64533587 missense probably benign
R0193:Grid2 UTSW 6 64063953 missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64345734 missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64666052 missense probably benign 0.33
R0600:Grid2 UTSW 6 63503435 missense probably benign 0.38
R0717:Grid2 UTSW 6 64666275 missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64429754 missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64429684 missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64429694 nonsense probably null
R1762:Grid2 UTSW 6 64533654 missense probably damaging 0.98
R1944:Grid2 UTSW 6 63909061 missense probably damaging 1.00
R1961:Grid2 UTSW 6 63908893 missense probably damaging 1.00
R1969:Grid2 UTSW 6 63908918 nonsense probably null
R2138:Grid2 UTSW 6 64345798 missense probably damaging 0.99
R3500:Grid2 UTSW 6 63503399 missense probably damaging 0.97
R3547:Grid2 UTSW 6 64320021 missense probably damaging 0.97
R3845:Grid2 UTSW 6 64345842 missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63503433 missense probably benign 0.41
R4273:Grid2 UTSW 6 63909045 missense probably damaging 1.00
R4591:Grid2 UTSW 6 64320102 missense probably damaging 1.00
R4701:Grid2 UTSW 6 64665915 missense probably benign 0.27
R4721:Grid2 UTSW 6 64666201 missense probably benign 0.33
R4755:Grid2 UTSW 6 63908988 missense probably benign 0.04
R4869:Grid2 UTSW 6 64429740 missense probably damaging 1.00
R5083:Grid2 UTSW 6 64320152 nonsense probably null
R5091:Grid2 UTSW 6 64076878 missense probably benign 0.07
R5117:Grid2 UTSW 6 63256933 missense probably benign 0.15
R5128:Grid2 UTSW 6 64665998 missense probably benign 0.01
R5386:Grid2 UTSW 6 63931105 missense probably damaging 0.99
R5404:Grid2 UTSW 6 63930910 missense probably damaging 0.99
R5534:Grid2 UTSW 6 63503361 missense probably benign
R5626:Grid2 UTSW 6 64076945 critical splice donor site probably null
R5699:Grid2 UTSW 6 63908991 missense probably damaging 0.99
R5700:Grid2 UTSW 6 64094432 missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64663162 missense probably damaging 1.00
R6446:Grid2 UTSW 6 64345593 missense probably damaging 1.00
R6694:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6895:Grid2 UTSW 6 64395299 missense probably damaging 0.99
R6999:Grid2 UTSW 6 64076909 missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64700418 missense unknown
R7126:Grid2 UTSW 6 64076810 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAATGAACCTGCTTTTCCATCC -3'
(R):5'- AGAGTTGTGCAGCTAATCCTCTC -3'

Sequencing Primer
(F):5'- AAGCCAGATCATAAATGAATCTGAG -3'
(R):5'- GGAGTCCATTCCAAAGTTTGTTTG -3'
Posted On2018-08-29