Incidental Mutation 'R6767:Trappc10'
ID531991
Institutional Source Beutler Lab
Gene Symbol Trappc10
Ensembl Gene ENSMUSG00000000374
Gene Nametrafficking protein particle complex 10
SynonymsTmem1, LOC380642, B230307C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6767 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78186725-78244641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78193511 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1064 (I1064T)
Ref Sequence ENSEMBL: ENSMUSP00000000384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000384]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000384
AA Change: I1064T

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374
AA Change: I1064T

DomainStartEndE-ValueType
Pfam:TRAPPC10 1016 1245 1.1e-45 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular phenotypes, including atrioventricular or ventricular septal defects, thymus hypoplasia, and eye defects such as microphthalmia or anophthalmia. Holoprosencephaly, anencephaly and severe craniofacial defects may be also present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Fasn T C 11: 120,817,487 I651V possibly damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Trappc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Trappc10 APN 10 78203877 splice site probably benign
IGL01375:Trappc10 APN 10 78188899 missense possibly damaging 0.75
IGL01413:Trappc10 APN 10 78197844 missense possibly damaging 0.87
IGL02413:Trappc10 APN 10 78210776 missense probably damaging 0.99
IGL03037:Trappc10 APN 10 78199035 unclassified probably benign
IGL03094:Trappc10 APN 10 78228920 splice site probably benign
IGL03164:Trappc10 APN 10 78220242 missense probably damaging 1.00
IGL03351:Trappc10 APN 10 78188761 missense probably damaging 1.00
IGL03055:Trappc10 UTSW 10 78214686 missense probably damaging 1.00
IGL03098:Trappc10 UTSW 10 78214686 missense probably damaging 1.00
R0304:Trappc10 UTSW 10 78210760 splice site probably benign
R0605:Trappc10 UTSW 10 78201497 missense possibly damaging 0.70
R1806:Trappc10 UTSW 10 78210776 missense probably damaging 0.99
R1856:Trappc10 UTSW 10 78196451 missense probably benign 0.00
R2045:Trappc10 UTSW 10 78209479 splice site probably benign
R2088:Trappc10 UTSW 10 78196334 missense probably benign 0.00
R2126:Trappc10 UTSW 10 78203924 missense possibly damaging 0.94
R2202:Trappc10 UTSW 10 78199042 critical splice donor site probably null
R2509:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2510:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2511:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2893:Trappc10 UTSW 10 78193401 missense probably benign 0.00
R3744:Trappc10 UTSW 10 78199090 missense probably benign 0.00
R3778:Trappc10 UTSW 10 78200802 missense possibly damaging 0.89
R3876:Trappc10 UTSW 10 78220186 splice site probably null
R3930:Trappc10 UTSW 10 78210403 missense probably benign 0.03
R4078:Trappc10 UTSW 10 78210382 missense probably damaging 1.00
R4111:Trappc10 UTSW 10 78196430 missense probably benign 0.09
R4418:Trappc10 UTSW 10 78217188 missense probably damaging 1.00
R4549:Trappc10 UTSW 10 78231458 missense probably damaging 1.00
R4695:Trappc10 UTSW 10 78197863 missense probably damaging 0.99
R4799:Trappc10 UTSW 10 78201590 missense possibly damaging 0.71
R5022:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5023:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5026:Trappc10 UTSW 10 78204288 missense possibly damaging 0.82
R5057:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5282:Trappc10 UTSW 10 78187860 missense probably damaging 1.00
R5363:Trappc10 UTSW 10 78188840 missense possibly damaging 0.92
R5813:Trappc10 UTSW 10 78222739 missense probably damaging 1.00
R5831:Trappc10 UTSW 10 78209426 missense probably damaging 1.00
R6209:Trappc10 UTSW 10 78214812 missense possibly damaging 0.50
R6450:Trappc10 UTSW 10 78209450 missense possibly damaging 0.92
R6520:Trappc10 UTSW 10 78201453 missense probably benign 0.00
R6533:Trappc10 UTSW 10 78188894 missense probably damaging 0.96
R6798:Trappc10 UTSW 10 78188831 missense probably benign 0.00
R7205:Trappc10 UTSW 10 78210428 missense probably damaging 1.00
R7282:Trappc10 UTSW 10 78207493 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAACACTCTCCGAGGATGCTG -3'
(R):5'- CAATGTAAATGTATGGAGTTGGGC -3'

Sequencing Primer
(F):5'- GATGCTGCACTTCACTGAAG -3'
(R):5'- GGCTTGCGTCTCTTAGAACTAGC -3'
Posted On2018-08-29