Incidental Mutation 'R6767:Atp8a2'
ID532008
Institutional Source Beutler Lab
Gene Symbol Atp8a2
Ensembl Gene ENSMUSG00000021983
Gene NameATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonymswl, Ib
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.737) question?
Stock #R6767 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location59638540-60197179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60046722 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 47 (F47S)
Ref Sequence ENSEMBL: ENSMUSP00000115592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080368] [ENSMUST00000131670] [ENSMUST00000145071]
Predicted Effect probably damaging
Transcript: ENSMUST00000080368
AA Change: F47S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: F47S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 14 80 2.3e-27 PFAM
Pfam:E1-E2_ATPase 85 348 6.7e-15 PFAM
Pfam:HAD 385 790 3.2e-22 PFAM
Pfam:Cation_ATPase 465 564 3.2e-14 PFAM
Pfam:PhoLip_ATPase_C 807 1059 2.8e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131670
AA Change: F66S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119395
Gene: ENSMUSG00000021983
AA Change: F66S

DomainStartEndE-ValueType
SCOP:d1eula_ 40 148 7e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145071
AA Change: F47S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115592
Gene: ENSMUSG00000021983
AA Change: F47S

DomainStartEndE-ValueType
SCOP:d1eula_ 21 129 1e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Fasn T C 11: 120,817,487 I651V possibly damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Atp8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Atp8a2 APN 14 59691461 missense probably benign 0.00
IGL01505:Atp8a2 APN 14 60028063 missense probably benign 0.00
IGL01614:Atp8a2 APN 14 60044988 missense probably damaging 0.99
IGL01621:Atp8a2 APN 14 60015868 splice site probably benign
IGL01634:Atp8a2 APN 14 59998062 missense probably benign 0.01
IGL01672:Atp8a2 APN 14 59691533 missense probably benign 0.01
IGL01898:Atp8a2 APN 14 60023513 missense probably damaging 1.00
IGL01945:Atp8a2 APN 14 60026160 missense probably damaging 1.00
IGL02006:Atp8a2 APN 14 59857048 missense possibly damaging 0.90
IGL02089:Atp8a2 APN 14 60026920 splice site probably null
IGL02211:Atp8a2 APN 14 60027976 missense probably benign 0.00
IGL02283:Atp8a2 APN 14 60016799 missense possibly damaging 0.86
IGL02337:Atp8a2 APN 14 59998002 missense probably benign 0.32
IGL02571:Atp8a2 APN 14 60012458 splice site probably benign
IGL02795:Atp8a2 APN 14 60033742 missense probably damaging 0.96
IGL02874:Atp8a2 APN 14 59802252 missense probably damaging 1.00
IGL02999:Atp8a2 APN 14 59925122 nonsense probably null
IGL03307:Atp8a2 APN 14 60015872 critical splice donor site probably null
IGL03345:Atp8a2 APN 14 59774011 missense probably benign
PIT4431001:Atp8a2 UTSW 14 59654626 missense probably benign
R0334:Atp8a2 UTSW 14 59691512 missense probably damaging 1.00
R0368:Atp8a2 UTSW 14 59860212 missense probably damaging 1.00
R0420:Atp8a2 UTSW 14 59773744 missense probably damaging 1.00
R0684:Atp8a2 UTSW 14 60023144 missense probably benign 0.00
R0755:Atp8a2 UTSW 14 60009881 missense possibly damaging 0.96
R0853:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0908:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0991:Atp8a2 UTSW 14 59793929 missense probably benign 0.33
R1025:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1190:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1387:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1426:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1442:Atp8a2 UTSW 14 59860323 splice site probably benign
R1472:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1538:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1573:Atp8a2 UTSW 14 59860206 missense probably benign 0.00
R1620:Atp8a2 UTSW 14 59791183 missense probably benign
R1661:Atp8a2 UTSW 14 59860186 missense possibly damaging 0.80
R1673:Atp8a2 UTSW 14 59791240 missense probably benign 0.00
R1749:Atp8a2 UTSW 14 59860174 nonsense probably null
R1796:Atp8a2 UTSW 14 60020758 critical splice donor site probably null
R1815:Atp8a2 UTSW 14 60086624 missense probably damaging 1.00
R1836:Atp8a2 UTSW 14 60006366 missense possibly damaging 0.49
R1935:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1936:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1937:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R2416:Atp8a2 UTSW 14 59925008 missense probably damaging 1.00
R2760:Atp8a2 UTSW 14 59860192 missense probably benign 0.43
R3029:Atp8a2 UTSW 14 59691465 frame shift probably null
R3621:Atp8a2 UTSW 14 60026138 splice site probably null
R3768:Atp8a2 UTSW 14 60044336 missense probably benign 0.19
R3784:Atp8a2 UTSW 14 59773966 missense probably damaging 1.00
R3896:Atp8a2 UTSW 14 60026140 critical splice donor site probably null
R4009:Atp8a2 UTSW 14 60027985 missense possibly damaging 0.54
R4591:Atp8a2 UTSW 14 59654629 missense probably benign 0.03
R4866:Atp8a2 UTSW 14 59691467 missense probably damaging 1.00
R4879:Atp8a2 UTSW 14 60008469 nonsense probably null
R5059:Atp8a2 UTSW 14 59691537 missense probably benign 0.00
R5529:Atp8a2 UTSW 14 59793865 critical splice donor site probably null
R5788:Atp8a2 UTSW 14 60020793 missense probably damaging 0.96
R6126:Atp8a2 UTSW 14 60044326 missense probably benign
R6295:Atp8a2 UTSW 14 60012399 nonsense probably null
R6393:Atp8a2 UTSW 14 59773755 nonsense probably null
R6454:Atp8a2 UTSW 14 60008499 splice site probably null
R6651:Atp8a2 UTSW 14 59774021 missense probably benign 0.00
R6763:Atp8a2 UTSW 14 60008408 missense probably benign 0.12
R6912:Atp8a2 UTSW 14 60012410 missense probably benign 0.33
R7032:Atp8a2 UTSW 14 60017840 intron probably null
Z1088:Atp8a2 UTSW 14 60027970 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAAGATCAGGTCTGTCCC -3'
(R):5'- CCCATGGGAAAGTGGAATGTC -3'

Sequencing Primer
(F):5'- CCCCCTAGTGATAATTTGAGGAAG -3'
(R):5'- TCCATATCAAAGATTGAATTGCAAAC -3'
Posted On2018-08-29