Incidental Mutation 'R6768:1110051M20Rik'
List |< first << previous [record 27 of 55675] next >> last >|
ID532026
Institutional Source Beutler Lab
Gene Symbol 1110051M20Rik
Ensembl Gene ENSMUSG00000040591
Gene NameRIKEN cDNA 1110051M20 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R6768 (G1)
Quality Score114.008
Status Not validated
Chromosome2
Chromosomal Location91275068-91444704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91421958 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 19 (H19Q)
Ref Sequence ENSEMBL: ENSMUSP00000099654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064652] [ENSMUST00000094835] [ENSMUST00000102594]
Predicted Effect probably damaging
Transcript: ENSMUST00000064652
AA Change: H19Q

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000094835
SMART Domains Protein: ENSMUSP00000092431
Gene: ENSMUSG00000040591

DomainStartEndE-ValueType
low complexity region 219 234 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102594
AA Change: H19Q

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099654
Gene: ENSMUSG00000040591
AA Change: H19Q

DomainStartEndE-ValueType
low complexity region 316 331 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b G A 12: 113,490,243 V227I probably benign Het
Agtrap A G 4: 148,081,610 V106A probably benign Het
Aldh3a2 A C 11: 61,253,710 S341A probably benign Het
Bmper T A 9: 23,381,453 C353S probably damaging Het
Casq1 C T 1: 172,219,678 D5N probably benign Het
Ccin G A 4: 43,984,574 R327H probably benign Het
Chuk A G 19: 44,096,951 V252A probably damaging Het
Cpeb3 G A 19: 37,025,032 T643I possibly damaging Het
Ctcfl A G 2: 173,117,291 V214A possibly damaging Het
Dst A G 1: 34,181,712 E2199G probably damaging Het
Eno2 T C 6: 124,767,748 E45G probably damaging Het
Foxa2 T C 2: 148,043,827 H181R probably damaging Het
Fpgs A G 2: 32,686,623 S331P probably benign Het
Gm47189 A G 14: 41,770,078 S81P probably benign Het
Igsf8 C A 1: 172,317,532 P142Q probably damaging Het
Islr G T 9: 58,157,610 Q205K possibly damaging Het
Josd1 A G 15: 79,677,122 W162R probably benign Het
Lrrc37a G A 11: 103,500,123 T1492I probably benign Het
Meox1 A G 11: 101,879,335 F189L probably damaging Het
Mtf1 G A 4: 124,837,785 D385N probably benign Het
Naip2 A T 13: 100,178,324 C315* probably null Het
Ncaph2 T A 15: 89,363,999 Y166* probably null Het
Nr1i3 G A 1: 171,217,397 V270M probably damaging Het
Olfr155 T C 4: 43,854,351 I14T probably benign Het
Olfr747 A G 14: 50,681,592 L14S probably damaging Het
Panx3 T C 9: 37,664,026 K180R probably benign Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Reln A C 5: 21,978,907 V1698G probably damaging Het
Rnf213 G T 11: 119,442,236 R2757L probably damaging Het
Scgb2b26 G T 7: 33,944,954 T4K probably damaging Het
Sdhb A G 4: 140,979,053 E267G probably damaging Het
Sorbs1 A T 19: 40,327,547 N383K probably damaging Het
Stk11ip T A 1: 75,532,635 C766S probably benign Het
Taf6l A C 19: 8,774,549 S592A probably damaging Het
Tmem145 G A 7: 25,308,636 G235D probably damaging Het
Tuba3b T A 6: 145,618,729 probably null Het
Ubl7 A T 9: 57,912,762 E32D probably benign Het
Vmn1r168 A T 7: 23,541,035 T106S probably damaging Het
Vmn2r59 C A 7: 42,011,968 V808F probably benign Het
Vmn2r61 C T 7: 42,300,324 P723S probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp11 G T 5: 129,658,351 D15E probably benign Het
Zfp428 G A 7: 24,515,483 G162R probably damaging Het
Zfp629 G A 7: 127,610,825 T604I probably benign Het
Zfpm1 C A 8: 122,334,456 D253E probably damaging Het
Zhx1 G T 15: 58,054,103 T249K probably benign Het
Other mutations in 1110051M20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02737:1110051M20Rik APN 2 91304797 missense probably damaging 1.00
R0295:1110051M20Rik UTSW 2 91282594 missense probably damaging 1.00
R0437:1110051M20Rik UTSW 2 91421953 missense probably damaging 0.99
R0446:1110051M20Rik UTSW 2 91304764 missense possibly damaging 0.93
R0846:1110051M20Rik UTSW 2 91383837 missense probably damaging 0.98
R6888:1110051M20Rik UTSW 2 91421894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCTGTGGGCCAAGAATTC -3'
(R):5'- GGACCATAGCTCAGTTATGGCC -3'

Sequencing Primer
(F):5'- GAATCTATGGGGGCCAAACCTATTC -3'
(R):5'- CTCAGTTATGGCCAACGAACTTTG -3'
Posted On2018-08-29