Incidental Mutation 'R6768:Mtf1'
ID532031
Institutional Source Beutler Lab
Gene Symbol Mtf1
Ensembl Gene ENSMUSG00000028890
Gene Namemetal response element binding transcription factor 1
SynonymsThyls, metalloregulatory transcription factor, MTF-1, metal response element-binding transcription factor 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6768 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location124802104-124849800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 124837785 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 385 (D385N)
Ref Sequence ENSEMBL: ENSMUSP00000101799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030723] [ENSMUST00000106193]
Predicted Effect probably benign
Transcript: ENSMUST00000030723
AA Change: D385N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000030723
Gene: ENSMUSG00000028890
AA Change: D385N

DomainStartEndE-ValueType
ZnF_C2H2 139 163 1.22e-4 SMART
ZnF_C2H2 169 193 6.42e-4 SMART
ZnF_C2H2 199 223 2.4e-3 SMART
ZnF_C2H2 228 252 2.57e-3 SMART
ZnF_C2H2 258 282 2.57e-3 SMART
ZnF_C2H2 288 312 7.37e-4 SMART
low complexity region 429 456 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 545 558 N/A INTRINSIC
low complexity region 628 638 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106193
AA Change: D385N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101799
Gene: ENSMUSG00000028890
AA Change: D385N

DomainStartEndE-ValueType
ZnF_C2H2 139 163 1.22e-4 SMART
ZnF_C2H2 169 193 6.42e-4 SMART
ZnF_C2H2 199 223 2.4e-3 SMART
ZnF_C2H2 228 252 2.57e-3 SMART
ZnF_C2H2 258 282 2.57e-3 SMART
ZnF_C2H2 288 312 7.37e-4 SMART
low complexity region 429 456 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 545 558 N/A INTRINSIC
low complexity region 628 638 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that induces expression of metallothioneins and other genes involved in metal homeostasis in response to heavy metals such as cadmium, zinc, copper, and silver. The protein is a nucleocytoplasmic shuttling protein that accumulates in the nucleus upon heavy metal exposure and binds to promoters containing a metal-responsive element (MRE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation show impaired hepatocyte development followed by embryonic liver degeneration, generalized edema, and death at ~14 days of gestation. Mutant embryonic fibroblasts show increased susceptibility to the cytotoxiceffects of cadmium and hydrogen peroxide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,421,958 H19Q probably damaging Het
Adam6b G A 12: 113,490,243 V227I probably benign Het
Agtrap A G 4: 148,081,610 V106A probably benign Het
Aldh3a2 A C 11: 61,253,710 S341A probably benign Het
Bmper T A 9: 23,381,453 C353S probably damaging Het
Casq1 C T 1: 172,219,678 D5N probably benign Het
Ccin G A 4: 43,984,574 R327H probably benign Het
Chuk A G 19: 44,096,951 V252A probably damaging Het
Colec11 T C 12: 28,595,101 probably null Het
Cpeb3 G A 19: 37,025,032 T643I possibly damaging Het
Ctcfl A G 2: 173,117,291 V214A possibly damaging Het
Dst A G 1: 34,181,712 E2199G probably damaging Het
Eno2 T C 6: 124,767,748 E45G probably damaging Het
Foxa2 T C 2: 148,043,827 H181R probably damaging Het
Fpgs A G 2: 32,686,623 S331P probably benign Het
Gm47189 A G 14: 41,770,078 S81P probably benign Het
Igsf8 C A 1: 172,317,532 P142Q probably damaging Het
Islr G T 9: 58,157,610 Q205K possibly damaging Het
Josd1 A G 15: 79,677,122 W162R probably benign Het
Lrrc37a G A 11: 103,500,123 T1492I probably benign Het
Meox1 A G 11: 101,879,335 F189L probably damaging Het
Naip2 A T 13: 100,178,324 C315* probably null Het
Ncaph2 T A 15: 89,363,999 Y166* probably null Het
Nr1i3 G A 1: 171,217,397 V270M probably damaging Het
Olfr155 T C 4: 43,854,351 I14T probably benign Het
Olfr747 A G 14: 50,681,592 L14S probably damaging Het
Panx3 T C 9: 37,664,026 K180R probably benign Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Reln A C 5: 21,978,907 V1698G probably damaging Het
Rnf213 G T 11: 119,442,236 R2757L probably damaging Het
Scgb2b26 G T 7: 33,944,954 T4K probably damaging Het
Sdhb A G 4: 140,979,053 E267G probably damaging Het
Sorbs1 A T 19: 40,327,547 N383K probably damaging Het
Stk11ip T A 1: 75,532,635 C766S probably benign Het
Taf6l A C 19: 8,774,549 S592A probably damaging Het
Tmem145 G A 7: 25,308,636 G235D probably damaging Het
Tuba3b T A 6: 145,618,729 probably null Het
Ubl7 A T 9: 57,912,762 E32D probably benign Het
Vmn1r168 A T 7: 23,541,035 T106S probably damaging Het
Vmn2r59 C A 7: 42,011,968 V808F probably benign Het
Vmn2r61 C T 7: 42,300,324 P723S probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp11 G T 5: 129,658,351 D15E probably benign Het
Zfp428 G A 7: 24,515,483 G162R probably damaging Het
Zfp629 G A 7: 127,610,825 T604I probably benign Het
Zfpm1 C A 8: 122,334,456 D253E probably damaging Het
Zhx1 G T 15: 58,054,103 T249K probably benign Het
Other mutations in Mtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01902:Mtf1 APN 4 124804927 missense probably damaging 0.99
IGL02491:Mtf1 APN 4 124838579 missense probably benign 0.00
IGL02493:Mtf1 APN 4 124821319 missense probably damaging 1.00
IGL02644:Mtf1 APN 4 124820235 missense probably damaging 1.00
IGL02661:Mtf1 APN 4 124825109 missense probably damaging 0.98
IGL03018:Mtf1 APN 4 124838663 missense probably benign 0.44
LCD18:Mtf1 UTSW 4 124829316 intron probably benign
R0443:Mtf1 UTSW 4 124824282 unclassified probably benign
R0599:Mtf1 UTSW 4 124820201 splice site probably benign
R1103:Mtf1 UTSW 4 124838468 missense probably benign 0.28
R2496:Mtf1 UTSW 4 124838904 missense probably benign 0.01
R4258:Mtf1 UTSW 4 124838783 missense probably benign 0.00
R4818:Mtf1 UTSW 4 124804712 start codon destroyed probably null 1.00
R5085:Mtf1 UTSW 4 124821308 missense probably damaging 1.00
R5248:Mtf1 UTSW 4 124820427 missense probably damaging 1.00
R5368:Mtf1 UTSW 4 124825079 missense probably damaging 0.98
R6368:Mtf1 UTSW 4 124824352 missense probably damaging 1.00
R7417:Mtf1 UTSW 4 124825181 missense probably null 0.00
X0018:Mtf1 UTSW 4 124838847 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACTAGGGGCAGGAATCACATC -3'
(R):5'- CAGACACTTCCATTCTAGCAAGTG -3'

Sequencing Primer
(F):5'- GGAATCACATCAAACGATCATTCTGG -3'
(R):5'- TGTTACCTACACACGTAAGGAG -3'
Posted On2018-08-29