Incidental Mutation 'R6769:Atp9a'
ID532076
Institutional Source Beutler Lab
Gene Symbol Atp9a
Ensembl Gene ENSMUSG00000027546
Gene NameATPase, class II, type 9A
SynonymsClass II, IIa
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6769 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location168634438-168742409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 168674900 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 340 (Y340N)
Ref Sequence ENSEMBL: ENSMUSP00000104806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029060] [ENSMUST00000109175] [ENSMUST00000109176] [ENSMUST00000109177] [ENSMUST00000178504]
Predicted Effect probably damaging
Transcript: ENSMUST00000029060
AA Change: Y358N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029060
Gene: ENSMUSG00000027546
AA Change: Y358N

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109175
AA Change: Y342N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104804
Gene: ENSMUSG00000027546
AA Change: Y342N

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
Pfam:E1-E2_ATPase 92 352 7.2e-21 PFAM
Pfam:Hydrolase 369 781 1.4e-19 PFAM
Pfam:HAD 372 778 1.1e-14 PFAM
Pfam:Hydrolase_like2 448 563 3.4e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109176
AA Change: Y416N

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104805
Gene: ENSMUSG00000027546
AA Change: Y416N

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 97 163 1.9e-20 PFAM
Pfam:E1-E2_ATPase 166 418 5.8e-13 PFAM
Pfam:Hydrolase 443 855 2.8e-13 PFAM
Pfam:HAD 446 852 2.4e-14 PFAM
Pfam:Cation_ATPase 522 635 1.5e-6 PFAM
Pfam:PhoLip_ATPase_C 869 1098 1.7e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109177
AA Change: Y340N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104806
Gene: ENSMUSG00000027546
AA Change: Y340N

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
Pfam:E1-E2_ATPase 90 350 7.2e-21 PFAM
Pfam:Hydrolase 367 779 1.4e-19 PFAM
Pfam:HAD 370 776 1.1e-14 PFAM
Pfam:Hydrolase_like2 446 561 3.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178504
AA Change: Y358N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136793
Gene: ENSMUSG00000027546
AA Change: Y358N

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,461,461 H174Q probably damaging Het
Alox5 C A 6: 116,415,184 probably null Het
Amer3 C A 1: 34,588,249 A523D possibly damaging Het
Apoa4 G A 9: 46,243,167 M355I probably benign Het
Atp10b T C 11: 43,203,252 probably null Het
C1rb T G 6: 124,577,405 S382A probably benign Het
Csmd1 A G 8: 16,071,394 V1763A possibly damaging Het
Ctnnd1 C A 2: 84,619,925 R317L probably damaging Het
Ctnnd1 A T 2: 84,620,110 D255E probably damaging Het
Dmxl2 A T 9: 54,416,524 I1192N probably damaging Het
Efcab5 A G 11: 77,105,432 V1101A probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam129b C T 2: 32,895,654 Het
Fam69b A G 2: 26,634,863 R92G probably benign Het
Flg T C 3: 93,288,323 probably benign Het
Fras1 A G 5: 96,598,941 I623M possibly damaging Het
Gm7361 T A 5: 26,257,769 L3* probably null Het
Gpr35 T A 1: 92,982,704 M46K probably damaging Het
Ighv2-9 A T 12: 113,879,310 F46I possibly damaging Het
Kdm4b C T 17: 56,351,754 A33V possibly damaging Het
Klhl5 T A 5: 65,164,652 Y534N probably damaging Het
Mccc1 C T 3: 35,989,843 probably null Het
Memo1 A T 17: 74,201,278 F270L probably damaging Het
Mnat1 A G 12: 73,272,422 N273S probably benign Het
Nxpe3 C A 16: 55,866,108 G179V probably damaging Het
Olfr1477 T A 19: 13,502,954 F204I possibly damaging Het
Otp A G 13: 94,875,786 D6G probably damaging Het
Prdm5 T A 6: 65,862,936 I265K probably damaging Het
Ptpn4 T A 1: 119,715,968 N350I probably benign Het
Rassf10 A G 7: 112,954,428 M79V probably benign Het
Rassf4 T A 6: 116,641,472 D215V possibly damaging Het
Rbm12 A T 2: 156,097,455 I299N possibly damaging Het
Scfd2 T C 5: 74,531,456 H55R probably benign Het
Scn8a A G 15: 101,035,564 N1550D probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc30a5 A C 13: 100,813,860 S240A probably benign Het
Slc7a4 A G 16: 17,575,320 V205A possibly damaging Het
Syde2 G A 3: 145,999,048 G318E probably damaging Het
Ttn T A 2: 76,708,539 D34649V possibly damaging Het
Vmn2r83 T A 10: 79,478,022 S155T probably damaging Het
Other mutations in Atp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Atp9a APN 2 168640680 missense probably benign 0.24
IGL01594:Atp9a APN 2 168691012 missense probably damaging 1.00
IGL01911:Atp9a APN 2 168653561 missense probably damaging 1.00
IGL02606:Atp9a APN 2 168652668 missense probably damaging 1.00
IGL02639:Atp9a APN 2 168649620 missense probably damaging 1.00
IGL03011:Atp9a APN 2 168652632 missense probably damaging 1.00
IGL03294:Atp9a APN 2 168689305 missense probably benign 0.04
IGL03310:Atp9a APN 2 168639959 missense probably damaging 1.00
R0114:Atp9a UTSW 2 168710856 nonsense probably null
R0194:Atp9a UTSW 2 168643885 missense probably benign 0.00
R0427:Atp9a UTSW 2 168640697 critical splice acceptor site probably null
R0508:Atp9a UTSW 2 168649526 splice site probably null
R1611:Atp9a UTSW 2 168673569 missense probably damaging 1.00
R2120:Atp9a UTSW 2 168653537 missense probably damaging 1.00
R2330:Atp9a UTSW 2 168639929 missense probably benign 0.01
R2348:Atp9a UTSW 2 168710826 splice site probably benign
R2404:Atp9a UTSW 2 168675363 critical splice acceptor site probably null
R2881:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R2882:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R4029:Atp9a UTSW 2 168689325 missense probably damaging 1.00
R4371:Atp9a UTSW 2 168649615 missense probably damaging 1.00
R4411:Atp9a UTSW 2 168661933 missense probably damaging 1.00
R4446:Atp9a UTSW 2 168681997 missense possibly damaging 0.75
R4583:Atp9a UTSW 2 168689360 splice site probably null
R4626:Atp9a UTSW 2 168639943 missense probably damaging 1.00
R4661:Atp9a UTSW 2 168637672 missense possibly damaging 0.52
R4679:Atp9a UTSW 2 168661964 missense possibly damaging 0.95
R4738:Atp9a UTSW 2 168668181 missense probably benign
R5191:Atp9a UTSW 2 168662063 missense possibly damaging 0.51
R5216:Atp9a UTSW 2 168674888 missense probably benign 0.38
R5280:Atp9a UTSW 2 168639988 missense possibly damaging 0.66
R5509:Atp9a UTSW 2 168639937 missense probably damaging 1.00
R5798:Atp9a UTSW 2 168690964 critical splice donor site probably null
R5807:Atp9a UTSW 2 168653534 missense probably damaging 0.98
R5926:Atp9a UTSW 2 168706271 missense probably damaging 1.00
R6046:Atp9a UTSW 2 168634870 missense probably benign 0.42
R6244:Atp9a UTSW 2 168689352 critical splice acceptor site probably null
R6307:Atp9a UTSW 2 168668170 missense probably benign 0.02
R6345:Atp9a UTSW 2 168676173 missense probably damaging 0.99
R6442:Atp9a UTSW 2 168649561 missense probably benign 0.01
R6459:Atp9a UTSW 2 168668013 missense probably damaging 1.00
R6771:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6841:Atp9a UTSW 2 168654220 missense possibly damaging 0.87
R7271:Atp9a UTSW 2 168734127
R7422:Atp9a UTSW 2 168648593 missense probably damaging 1.00
R7490:Atp9a UTSW 2 168675352 missense not run
Predicted Primers PCR Primer
(F):5'- TTCCTCTTGGTGCACTAGGG -3'
(R):5'- AAAAGCTTCCACACGGCTG -3'

Sequencing Primer
(F):5'- GGAGAAAGACAGCTGCCACAC -3'
(R):5'- CACGGCTGTGTGGCAGG -3'
Posted On2018-08-29