Incidental Mutation 'R6773:Tns1'
ID532227
Institutional Source Beutler Lab
Gene Symbol Tns1
Ensembl Gene ENSMUSG00000055322
Gene Nametensin 1
Synonyms1110018I21Rik, 1200014E20Rik, E030018G17Rik, E030037J05Rik, Tns
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.631) question?
Stock #R6773 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location73910231-74124449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73919707 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 445 (Q445R)
Ref Sequence ENSEMBL: ENSMUSP00000139844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000187691] [ENSMUST00000191104] [ENSMUST00000212888]
Predicted Effect probably damaging
Transcript: ENSMUST00000169786
AA Change: Q1709R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322
AA Change: Q1709R

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 1.77e-2 SMART
low complexity region 154 167 N/A INTRINSIC
SCOP:d1d5ra2 176 348 3e-32 SMART
PTEN_C2 350 477 1.12e-51 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1227 1239 N/A INTRINSIC
low complexity region 1284 1300 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
low complexity region 1518 1530 N/A INTRINSIC
SH2 1614 1716 6.85e-17 SMART
PTB 1747 1888 1.69e-29 SMART
Predicted Effect unknown
Transcript: ENSMUST00000185331
AA Change: Q1525R
Predicted Effect unknown
Transcript: ENSMUST00000185702
AA Change: Q1539R
Predicted Effect probably damaging
Transcript: ENSMUST00000187584
AA Change: Q1644R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322
AA Change: Q1644R

DomainStartEndE-ValueType
C1 21 67 8.6e-5 SMART
low complexity region 113 124 N/A INTRINSIC
PTPc_DSPc 197 319 9.9e-6 SMART
PTEN_C2 306 433 5.6e-56 SMART
low complexity region 778 789 N/A INTRINSIC
low complexity region 861 878 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1219 1235 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1453 1465 N/A INTRINSIC
SH2 1549 1651 4.3e-19 SMART
PTB 1682 1823 9e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187691
AA Change: Q445R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139844
Gene: ENSMUSG00000055322
AA Change: Q445R

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
SH2 350 452 4.3e-19 SMART
PTB 483 624 9e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191104
AA Change: Q1688R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322
AA Change: Q1688R

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 8.6e-5 SMART
low complexity region 154 167 N/A INTRINSIC
PTPc_DSPc 241 363 9.9e-6 SMART
PTEN_C2 350 477 5.6e-56 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1206 1218 N/A INTRINSIC
low complexity region 1263 1279 N/A INTRINSIC
low complexity region 1438 1449 N/A INTRINSIC
low complexity region 1497 1509 N/A INTRINSIC
SH2 1593 1695 4.3e-19 SMART
PTB 1726 1867 9e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212888
AA Change: Q1701R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp6 A G 15: 99,602,677 D161G probably damaging Het
Aqr A T 2: 114,148,996 N319K possibly damaging Het
Asns C A 6: 7,676,284 R424L probably benign Het
Atp4a T C 7: 30,715,377 V197A probably damaging Het
Ccdc70 A G 8: 21,973,305 E37G probably damaging Het
Ccdc88b A T 19: 6,849,041 V1102E possibly damaging Het
Cd82 G A 2: 93,421,876 A130V probably benign Het
Cfap46 T C 7: 139,642,561 probably benign Het
Cnot6l A C 5: 96,094,299 C188W probably damaging Het
Cxcr6 A T 9: 123,810,290 T119S possibly damaging Het
Dok7 G A 5: 35,077,184 R193H probably damaging Het
Dpy19l1 A T 9: 24,440,772 S386T probably damaging Het
Frem3 A C 8: 80,611,815 T246P probably damaging Het
Gm29666 A T 15: 84,914,159 I67K unknown Het
Gm9774 T A 3: 92,429,249 I49F probably damaging Het
Gpr153 T A 4: 152,279,300 V59E probably damaging Het
Inpp4b G A 8: 81,856,620 probably benign Het
Kcnj13 T C 1: 87,386,760 I247V possibly damaging Het
Klri1 C T 6: 129,703,547 V91M possibly damaging Het
M1ap T A 6: 82,968,080 D118E probably damaging Het
Map4 T C 9: 110,034,925 V406A probably benign Het
Nedd4l T C 18: 65,167,551 V369A probably benign Het
Olfr206 A T 16: 59,345,216 L162I probably damaging Het
Otud4 A G 8: 79,643,806 Y71C possibly damaging Het
Plcl1 A G 1: 55,751,302 N1044D probably benign Het
Ppp4r3b T A 11: 29,205,639 M114K probably benign Het
Prune1 T C 3: 95,263,771 D114G probably damaging Het
Rad54l2 A T 9: 106,693,317 V1268D probably benign Het
Rbbp6 A G 7: 122,999,355 probably benign Het
Rimbp3 A T 16: 17,209,015 E101V probably damaging Het
Rit1 C T 3: 88,726,369 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Shisa9 A G 16: 11,985,028 T150A probably damaging Het
Smpdl3a T C 10: 57,802,437 V112A probably damaging Het
Strada T A 11: 106,164,907 I305F probably damaging Het
Svep1 C T 4: 58,049,146 E3454K possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tmem259 T C 10: 79,977,588 D519G possibly damaging Het
Topbp1 A G 9: 103,343,692 D20G possibly damaging Het
Trbv5 G T 6: 41,062,617 W52L probably damaging Het
Trpc6 A T 9: 8,634,057 H379L probably damaging Het
Tulp1 T C 17: 28,362,902 K193E probably damaging Het
Unc80 T C 1: 66,651,543 V2459A probably benign Het
Vps50 T C 6: 3,592,560 V731A probably benign Het
Other mutations in Tns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tns1 APN 1 73924969 missense probably damaging 0.99
IGL01288:Tns1 APN 1 73953810 missense probably damaging 1.00
IGL01536:Tns1 APN 1 73919648 splice site probably benign
IGL01568:Tns1 APN 1 73953509 missense probably damaging 1.00
IGL01683:Tns1 APN 1 73953269 missense probably damaging 0.98
IGL02267:Tns1 APN 1 73992131 missense possibly damaging 0.95
IGL02597:Tns1 APN 1 73985873 critical splice donor site probably null
IGL02819:Tns1 APN 1 73937248 missense probably damaging 0.99
IGL03370:Tns1 APN 1 73985894 missense probably damaging 1.00
R0087:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
R0207:Tns1 UTSW 1 73937318 critical splice acceptor site probably null
R0411:Tns1 UTSW 1 73925761 missense probably damaging 0.96
R0543:Tns1 UTSW 1 73952697 missense probably benign 0.01
R0552:Tns1 UTSW 1 73920563 missense probably damaging 1.00
R0720:Tns1 UTSW 1 73925581 missense probably benign 0.03
R0828:Tns1 UTSW 1 73919666 missense probably damaging 1.00
R1034:Tns1 UTSW 1 73941969 missense probably damaging 1.00
R1061:Tns1 UTSW 1 73917672 missense probably damaging 1.00
R1819:Tns1 UTSW 1 73916476 splice site probably benign
R1826:Tns1 UTSW 1 73953634 start codon destroyed probably null 0.91
R2208:Tns1 UTSW 1 74079240 missense probably damaging 1.00
R3723:Tns1 UTSW 1 73924940 missense probably damaging 0.99
R4079:Tns1 UTSW 1 73995308 missense probably damaging 1.00
R4111:Tns1 UTSW 1 73941932 missense probably damaging 1.00
R4155:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4156:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4157:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4274:Tns1 UTSW 1 73928098 missense probably damaging 1.00
R4426:Tns1 UTSW 1 73985749 missense probably damaging 0.97
R4649:Tns1 UTSW 1 73953771 missense probably damaging 1.00
R4742:Tns1 UTSW 1 74124290 critical splice donor site probably null
R4869:Tns1 UTSW 1 73952615 missense probably benign
R4961:Tns1 UTSW 1 73935915 missense probably benign 0.35
R5025:Tns1 UTSW 1 73925482 missense probably damaging 1.00
R5035:Tns1 UTSW 1 73953820 start gained probably benign
R5062:Tns1 UTSW 1 73952864 missense probably damaging 1.00
R5080:Tns1 UTSW 1 73952940 missense probably damaging 1.00
R5213:Tns1 UTSW 1 73953612 missense probably damaging 1.00
R5256:Tns1 UTSW 1 73995426 intron probably benign
R5368:Tns1 UTSW 1 73941017 missense probably benign 0.07
R5391:Tns1 UTSW 1 73990409 splice site probably null
R5587:Tns1 UTSW 1 73920596 missense possibly damaging 0.94
R5735:Tns1 UTSW 1 73927979 missense probably benign 0.00
R5855:Tns1 UTSW 1 73918033 missense possibly damaging 0.83
R5999:Tns1 UTSW 1 73928097 nonsense probably null
R6122:Tns1 UTSW 1 73952419 critical splice donor site probably null
R6148:Tns1 UTSW 1 73953453 missense probably damaging 1.00
R6457:Tns1 UTSW 1 73918050 missense probably damaging 0.99
R6525:Tns1 UTSW 1 73953470 missense probably damaging 1.00
R6712:Tns1 UTSW 1 74079301 nonsense probably null
R6825:Tns1 UTSW 1 74002323 nonsense probably null
R7085:Tns1 UTSW 1 73925462 missense probably benign 0.00
R7128:Tns1 UTSW 1 73995304 missense
R7209:Tns1 UTSW 1 73953915 missense possibly damaging 0.68
R7348:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACAATCTGGCCAATCAATTAATGGG -3'
(R):5'- GGGCAGGTTTTCAATTCTGC -3'

Sequencing Primer
(F):5'- CTGGCCAATCAATTAATGGGTGTTC -3'
(R):5'- CTGGGATGTGGCTCAGGTCC -3'
Posted On2018-08-29