Incidental Mutation 'R6773:Cfap46'
ID532245
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Namecilia and flagella associated protein 46
Synonyms9330101J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6773 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139600951-139683817 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 139642561 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]
Predicted Effect unknown
Transcript: ENSMUST00000129990
AA Change: T1167A
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: T1167A

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140820
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155075
Meta Mutation Damage Score 0.0476 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp6 A G 15: 99,602,677 D161G probably damaging Het
Aqr A T 2: 114,148,996 N319K possibly damaging Het
Asns C A 6: 7,676,284 R424L probably benign Het
Atp4a T C 7: 30,715,377 V197A probably damaging Het
Ccdc70 A G 8: 21,973,305 E37G probably damaging Het
Ccdc88b A T 19: 6,849,041 V1102E possibly damaging Het
Cd82 G A 2: 93,421,876 A130V probably benign Het
Cnot6l A C 5: 96,094,299 C188W probably damaging Het
Cxcr6 A T 9: 123,810,290 T119S possibly damaging Het
Dok7 G A 5: 35,077,184 R193H probably damaging Het
Dpy19l1 A T 9: 24,440,772 S386T probably damaging Het
Frem3 A C 8: 80,611,815 T246P probably damaging Het
Gm29666 A T 15: 84,914,159 I67K unknown Het
Gm9774 T A 3: 92,429,249 I49F probably damaging Het
Gpr153 T A 4: 152,279,300 V59E probably damaging Het
Inpp4b G A 8: 81,856,620 probably benign Het
Kcnj13 T C 1: 87,386,760 I247V possibly damaging Het
Klri1 C T 6: 129,703,547 V91M possibly damaging Het
M1ap T A 6: 82,968,080 D118E probably damaging Het
Map4 T C 9: 110,034,925 V406A probably benign Het
Nedd4l T C 18: 65,167,551 V369A probably benign Het
Olfr206 A T 16: 59,345,216 L162I probably damaging Het
Otud4 A G 8: 79,643,806 Y71C possibly damaging Het
Plcl1 A G 1: 55,751,302 N1044D probably benign Het
Ppp4r3b T A 11: 29,205,639 M114K probably benign Het
Prune1 T C 3: 95,263,771 D114G probably damaging Het
Rad54l2 A T 9: 106,693,317 V1268D probably benign Het
Rbbp6 A G 7: 122,999,355 probably benign Het
Rimbp3 A T 16: 17,209,015 E101V probably damaging Het
Rit1 C T 3: 88,726,369 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Shisa9 A G 16: 11,985,028 T150A probably damaging Het
Smpdl3a T C 10: 57,802,437 V112A probably damaging Het
Strada T A 11: 106,164,907 I305F probably damaging Het
Svep1 C T 4: 58,049,146 E3454K possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tmem259 T C 10: 79,977,588 D519G possibly damaging Het
Tns1 T C 1: 73,919,707 Q445R probably damaging Het
Topbp1 A G 9: 103,343,692 D20G possibly damaging Het
Trbv5 G T 6: 41,062,617 W52L probably damaging Het
Trpc6 A T 9: 8,634,057 H379L probably damaging Het
Tulp1 T C 17: 28,362,902 K193E probably damaging Het
Unc80 T C 1: 66,651,543 V2459A probably benign Het
Vps50 T C 6: 3,592,560 V731A probably benign Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTGACATCCTCTGAGCTGAC -3'
(R):5'- CCGCTGTACCTTTCCACTAAAG -3'

Sequencing Primer
(F):5'- TCTGAGCTGACCCACGAAG -3'
(R):5'- AGGACTTCACCACATATAGAGC -3'
Posted On2018-08-29