Incidental Mutation 'R6774:Ntng2'
ID532270
Institutional Source Beutler Lab
Gene Symbol Ntng2
Ensembl Gene ENSMUSG00000035513
Gene Namenetrin G2
SynonymsLmnt2, 2610016D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location29194541-29253005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29197090 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 373 (T373A)
Ref Sequence ENSEMBL: ENSMUSP00000136659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048455] [ENSMUST00000091153] [ENSMUST00000102873] [ENSMUST00000177689] [ENSMUST00000183583]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048455
AA Change: T432A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035468
Gene: ENSMUSG00000035513
AA Change: T432A

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
low complexity region 372 385 N/A INTRINSIC
EGF_Lam 413 466 5.28e-5 SMART
EGF_Lam 469 511 4.12e-7 SMART
EGF 515 547 2.26e-4 SMART
low complexity region 574 589 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091153
AA Change: T407A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088688
Gene: ENSMUSG00000035513
AA Change: T407A

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 388 441 5.28e-5 SMART
EGF_Lam 444 486 4.12e-7 SMART
EGF 490 522 2.26e-4 SMART
low complexity region 549 564 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102873
AA Change: T373A

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099937
Gene: ENSMUSG00000035513
AA Change: T373A

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 354 407 5.28e-5 SMART
EGF_Lam 410 452 4.12e-7 SMART
EGF 456 488 2.26e-4 SMART
low complexity region 515 530 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177689
AA Change: T373A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136659
Gene: ENSMUSG00000035513
AA Change: T373A

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 354 407 5.28e-5 SMART
EGF_Lam 410 452 4.12e-7 SMART
EGF 456 488 2.26e-4 SMART
low complexity region 515 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183583
SMART Domains Protein: ENSMUSP00000139034
Gene: ENSMUSG00000035513

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
low complexity region 345 368 N/A INTRINSIC
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a subclass of the netrin family called netrin-G proteins. Unlike classic netrins, which act as diffusible chemoattractants, netrin-Gs are glycosylphosphatidylinositol-anchored membrane proteins that interact with specific transmembrane proteins. In mouse, this gene is preferentially expressed in the cerebral cortex, habenular nucleus and superior colliculus. Knockout mutant mice display a lack of behavioral startle in response to acoustic stimuli. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an absence of startle reflex and abnormal ABR amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Ntng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0388:Ntng2 UTSW 2 29207426 missense probably damaging 1.00
R0526:Ntng2 UTSW 2 29197062 missense probably damaging 1.00
R1835:Ntng2 UTSW 2 29197057 nonsense probably null
R1961:Ntng2 UTSW 2 29197098 missense probably damaging 1.00
R2507:Ntng2 UTSW 2 29207519 missense probably damaging 1.00
R2920:Ntng2 UTSW 2 29204211 missense probably benign
R3944:Ntng2 UTSW 2 29204277 missense probably benign 0.02
R3954:Ntng2 UTSW 2 29207535 missense probably damaging 0.97
R6235:Ntng2 UTSW 2 29227979 missense probably damaging 1.00
R6742:Ntng2 UTSW 2 29200928 missense probably benign
R6751:Ntng2 UTSW 2 29228043 missense possibly damaging 0.89
R6907:Ntng2 UTSW 2 29228206 missense probably damaging 1.00
R6964:Ntng2 UTSW 2 29197029 missense probably benign 0.02
R6995:Ntng2 UTSW 2 29197068 missense probably damaging 1.00
R7214:Ntng2 UTSW 2 29227720 missense probably damaging 0.99
R7249:Ntng2 UTSW 2 29227992 missense probably benign 0.03
X0023:Ntng2 UTSW 2 29197063 nonsense probably null
X0028:Ntng2 UTSW 2 29197149 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGTAGTGGATCAGAGGGCTTC -3'
(R):5'- AAAGATGCTTCCTGCCACCTTC -3'

Sequencing Primer
(F):5'- TCCCCTTAGAGATGCCCAGATG -3'
(R):5'- CCCTGTATATTCCTGGGTATGC -3'
Posted On2018-08-29