Incidental Mutation 'R6774:Kif17'
ID532278
Institutional Source Beutler Lab
Gene Symbol Kif17
Ensembl Gene ENSMUSG00000028758
Gene Namekinesin family member 17
SynonymsN-4 kinesin, 5930435E01Rik, Kif17b
MMRRC Submission
Accession Numbers

Genbank: NM_010623; MGI: 1098229

Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location138250435-138301967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138274995 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 170 (Y170C)
Ref Sequence ENSEMBL: ENSMUSP00000030539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030539] [ENSMUST00000105818] [ENSMUST00000105821]
Predicted Effect probably damaging
Transcript: ENSMUST00000030539
AA Change: Y170C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030539
Gene: ENSMUSG00000028758
AA Change: Y170C

DomainStartEndE-ValueType
KISc 3 343 4.57e-178 SMART
coiled coil region 400 470 N/A INTRINSIC
low complexity region 723 736 N/A INTRINSIC
coiled coil region 806 852 N/A INTRINSIC
low complexity region 983 1000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105818
AA Change: Y70C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101444
Gene: ENSMUSG00000028758
AA Change: Y70C

DomainStartEndE-ValueType
KISc 1 151 1.46e-13 SMART
coiled coil region 208 278 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
coiled coil region 615 661 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105821
AA Change: Y170C
SMART Domains Protein: ENSMUSP00000101447
Gene: ENSMUSG00000028758
AA Change: Y170C

DomainStartEndE-ValueType
KISc 3 343 4.57e-178 SMART
low complexity region 486 499 N/A INTRINSIC
coiled coil region 569 615 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired anterograde neuron transport, reduced NMDA-mediated synaptic currents, impaired synaptic plasticity, impaired long term object recognition memory, impaired spatial learning, and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Kif17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Kif17 APN 4 138262708 missense possibly damaging 0.66
IGL00973:Kif17 APN 4 138275057 missense probably benign 0.06
IGL01527:Kif17 APN 4 138269086 missense probably benign 0.21
IGL01559:Kif17 APN 4 138293769 missense probably damaging 0.99
IGL01736:Kif17 APN 4 138286565 missense possibly damaging 0.96
IGL02671:Kif17 APN 4 138288061 missense possibly damaging 0.85
IGL02976:Kif17 APN 4 138269063 missense probably damaging 1.00
IGL03051:Kif17 APN 4 138289254 missense probably damaging 0.99
IGL03285:Kif17 APN 4 138268990 missense probably damaging 0.97
easy_company UTSW 4 138288332 nonsense probably null
fiddle UTSW 4 138286480 missense probably benign 0.18
fidget UTSW 4 138269891 missense probably damaging 1.00
A5278:Kif17 UTSW 4 138287950 missense probably benign 0.33
R0012:Kif17 UTSW 4 138293748 missense probably damaging 0.99
R0012:Kif17 UTSW 4 138293748 missense probably damaging 0.99
R0133:Kif17 UTSW 4 138278245 missense possibly damaging 0.73
R0627:Kif17 UTSW 4 138288487 critical splice donor site probably null
R0670:Kif17 UTSW 4 138262499 unclassified probably benign
R0894:Kif17 UTSW 4 138298231 missense possibly damaging 0.93
R1367:Kif17 UTSW 4 138277994 nonsense probably null
R1648:Kif17 UTSW 4 138269895 missense probably damaging 1.00
R1674:Kif17 UTSW 4 138301258 missense probably benign 0.13
R1700:Kif17 UTSW 4 138262698 nonsense probably null
R1855:Kif17 UTSW 4 138288271 missense probably benign 0.44
R2137:Kif17 UTSW 4 138262667 missense probably damaging 0.98
R2170:Kif17 UTSW 4 138288371 missense probably benign 0.01
R3008:Kif17 UTSW 4 138278165 missense probably damaging 1.00
R3855:Kif17 UTSW 4 138291510 missense probably benign 0.18
R4591:Kif17 UTSW 4 138277799 missense probably benign 0.06
R4789:Kif17 UTSW 4 138281377 missense probably damaging 1.00
R5407:Kif17 UTSW 4 138298221 missense probably damaging 1.00
R5859:Kif17 UTSW 4 138291433 missense possibly damaging 0.71
R5901:Kif17 UTSW 4 138298332 splice site probably null
R5919:Kif17 UTSW 4 138269891 missense probably damaging 1.00
R6119:Kif17 UTSW 4 138288332 nonsense probably null
R6312:Kif17 UTSW 4 138288193 missense probably benign 0.40
R6693:Kif17 UTSW 4 138286480 missense probably benign 0.18
R6838:Kif17 UTSW 4 138278399 intron probably null
R6863:Kif17 UTSW 4 138269884 nonsense probably null
R7205:Kif17 UTSW 4 138293766 missense probably benign 0.21
R7307:Kif17 UTSW 4 138262643 missense probably benign 0.00
R7336:Kif17 UTSW 4 138298306 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CCATGCTCATGAAATAAGTGTTGC -3'
(R):5'- TCTCCAGGCTCCAATAAGGTG -3'

Sequencing Primer
(F):5'- ACCCATTTTACAGATGTGCTTG -3'
(R):5'- CAGGCTCCAATAAGGTGAGTCC -3'
Posted On2018-08-29