Incidental Mutation 'R6774:Olfr469'
ID532283
Institutional Source Beutler Lab
Gene Symbol Olfr469
Ensembl Gene ENSMUSG00000095910
Gene Nameolfactory receptor 469
SynonymsMOR204-21, GA_x6K02T2PBJ9-10152980-10152036
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107820566-107825541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107823188 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 94 (T94S)
Ref Sequence ENSEMBL: ENSMUSP00000150486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075704] [ENSMUST00000213252]
Predicted Effect probably benign
Transcript: ENSMUST00000075704
AA Change: T94S

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075122
Gene: ENSMUSG00000095910
AA Change: T94S

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.3e-53 PFAM
Pfam:7tm_1 44 293 2.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213252
AA Change: T94S

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Olfr469
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02205:Olfr469 APN 7 107822591 missense probably damaging 1.00
IGL02252:Olfr469 APN 7 107823146 missense probably benign 0.04
R0365:Olfr469 UTSW 7 107822917 nonsense probably null
R0647:Olfr469 UTSW 7 107823011 missense probably benign 0.02
R0863:Olfr469 UTSW 7 107823374 missense probably benign
R1830:Olfr469 UTSW 7 107823371 missense probably benign 0.02
R2189:Olfr469 UTSW 7 107822615 missense probably benign 0.09
R2316:Olfr469 UTSW 7 107822800 missense probably benign 0.25
R6187:Olfr469 UTSW 7 107822574 missense probably benign
R6305:Olfr469 UTSW 7 107822657 missense probably benign 0.01
R7019:Olfr469 UTSW 7 107823158 missense probably benign 0.04
R7205:Olfr469 UTSW 7 107822575 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGATTGACTCTATTTGGTCCAC -3'
(R):5'- TGTGCATCTACCTGGTGACTG -3'

Sequencing Primer
(F):5'- GACTCTATTTGGTCCACAGAAGAG -3'
(R):5'- CATCTACCTGGTGACTGTGTCTG -3'
Posted On2018-08-29