Incidental Mutation 'R6774:Pwwp2b'
ID532286
Institutional Source Beutler Lab
Gene Symbol Pwwp2b
Ensembl Gene ENSMUSG00000060260
Gene NamePWWP domain containing 2B
SynonymsD930023J19Rik, Pwwp2, D7Ertd517e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139248482-139269903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139255987 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 448 (V448A)
Ref Sequence ENSEMBL: ENSMUSP00000130888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093993] [ENSMUST00000172136]
Predicted Effect probably benign
Transcript: ENSMUST00000093993
AA Change: V448A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000091529
Gene: ENSMUSG00000060260
AA Change: V448A

DomainStartEndE-ValueType
low complexity region 105 120 N/A INTRINSIC
low complexity region 145 165 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
PDB:4LD6|A 485 506 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172136
AA Change: V448A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130888
Gene: ENSMUSG00000060260
AA Change: V448A

DomainStartEndE-ValueType
low complexity region 105 120 N/A INTRINSIC
low complexity region 145 165 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
Pfam:PWWP 498 583 5.5e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Pwwp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Pwwp2b APN 7 139254855 nonsense probably null
IGL02209:Pwwp2b APN 7 139255105 missense probably damaging 1.00
IGL02938:Pwwp2b APN 7 139256143 missense probably damaging 1.00
R0033:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R0033:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R1491:Pwwp2b UTSW 7 139255963 missense probably damaging 1.00
R1636:Pwwp2b UTSW 7 139254842 missense probably benign 0.00
R1672:Pwwp2b UTSW 7 139254831 missense probably benign
R1793:Pwwp2b UTSW 7 139256365 missense probably damaging 0.97
R2016:Pwwp2b UTSW 7 139256151 missense possibly damaging 0.91
R2159:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R2228:Pwwp2b UTSW 7 139255188 missense probably damaging 1.00
R2229:Pwwp2b UTSW 7 139255188 missense probably damaging 1.00
R2380:Pwwp2b UTSW 7 139255450 missense probably damaging 1.00
R3023:Pwwp2b UTSW 7 139256194 missense probably damaging 1.00
R3933:Pwwp2b UTSW 7 139256034 missense possibly damaging 0.66
R4440:Pwwp2b UTSW 7 139255639 missense probably benign 0.09
R4844:Pwwp2b UTSW 7 139255586 missense probably benign 0.09
R4873:Pwwp2b UTSW 7 139256062 missense possibly damaging 0.90
R4875:Pwwp2b UTSW 7 139256062 missense possibly damaging 0.90
R5022:Pwwp2b UTSW 7 139255578 missense possibly damaging 0.81
R5446:Pwwp2b UTSW 7 139255150 missense probably damaging 0.96
R5656:Pwwp2b UTSW 7 139255971 missense possibly damaging 0.93
R6465:Pwwp2b UTSW 7 139256035 missense probably benign 0.01
R6578:Pwwp2b UTSW 7 139256112 missense probably damaging 1.00
R7218:Pwwp2b UTSW 7 139256133 missense probably damaging 1.00
R7316:Pwwp2b UTSW 7 139256224 missense probably benign 0.29
X0017:Pwwp2b UTSW 7 139255806 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGGACTTGTCTTCTGGAAGTTC -3'
(R):5'- AAGGCTGATGTCAAGGACAC -3'

Sequencing Primer
(F):5'- TCTGGTGAGGACGATGACC -3'
(R):5'- ATGTCAAGGACACGCGCTG -3'
Posted On2018-08-29