Incidental Mutation 'R6774:Mmp1b'
ID532290
Institutional Source Beutler Lab
Gene Symbol Mmp1b
Ensembl Gene ENSMUSG00000041620
Gene Namematrix metallopeptidase 1b (interstitial collagenase)
SynonymsMcol-B
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location7368239-7388047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7387914 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 27 (K27E)
Ref Sequence ENSEMBL: ENSMUSP00000047261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047888]
Predicted Effect probably benign
Transcript: ENSMUST00000047888
AA Change: K27E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000047261
Gene: ENSMUSG00000041620
AA Change: K27E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:PG_binding_1 26 84 1.4e-13 PFAM
ZnMc 102 260 3.08e-46 SMART
HX 281 323 4.39e-2 SMART
HX 325 369 3.51e-10 SMART
HX 374 421 1.03e-16 SMART
HX 423 463 1.6e0 SMART
Meta Mutation Damage Score 0.1288 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Mmp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Mmp1b APN 9 7387946 missense probably benign 0.00
IGL00339:Mmp1b APN 9 7368304 missense probably benign 0.19
IGL00832:Mmp1b APN 9 7387023 missense possibly damaging 0.81
IGL01110:Mmp1b APN 9 7384921 missense probably benign 0.02
IGL02121:Mmp1b APN 9 7384935 missense probably benign 0.22
IGL02143:Mmp1b APN 9 7386400 missense probably benign 0.10
IGL02698:Mmp1b APN 9 7384877 missense probably damaging 1.00
IGL02928:Mmp1b APN 9 7368242 makesense probably null
IGL03218:Mmp1b APN 9 7387907 missense probably benign 0.07
IGL03304:Mmp1b APN 9 7384701 missense probably damaging 1.00
IGL02802:Mmp1b UTSW 9 7384709 missense probably benign 0.08
R0122:Mmp1b UTSW 9 7386689 missense probably damaging 0.99
R0506:Mmp1b UTSW 9 7387013 missense possibly damaging 0.52
R0600:Mmp1b UTSW 9 7387947 missense possibly damaging 0.55
R1454:Mmp1b UTSW 9 7386693 missense probably damaging 1.00
R1466:Mmp1b UTSW 9 7384779 splice site probably benign
R1696:Mmp1b UTSW 9 7386699 missense probably damaging 0.99
R1837:Mmp1b UTSW 9 7386409 missense probably damaging 1.00
R1986:Mmp1b UTSW 9 7368577 missense probably benign 0.01
R2031:Mmp1b UTSW 9 7368607 missense possibly damaging 0.68
R2098:Mmp1b UTSW 9 7386984 missense probably benign 0.03
R2107:Mmp1b UTSW 9 7369310 missense probably damaging 1.00
R2847:Mmp1b UTSW 9 7370763 missense probably benign 0.05
R2870:Mmp1b UTSW 9 7386875 synonymous silent
R3944:Mmp1b UTSW 9 7384708 missense possibly damaging 0.73
R4654:Mmp1b UTSW 9 7370849 missense probably benign 0.18
R4829:Mmp1b UTSW 9 7370729 critical splice donor site probably null
R5329:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5332:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5333:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5418:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5419:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5420:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R6053:Mmp1b UTSW 9 7385031 missense probably benign 0.07
R6394:Mmp1b UTSW 9 7386316 missense probably benign 0.20
R6842:Mmp1b UTSW 9 7384888 missense probably damaging 1.00
R7092:Mmp1b UTSW 9 7386981 missense probably damaging 1.00
R7146:Mmp1b UTSW 9 7385014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACACTTATAGAGGGAGTTGC -3'
(R):5'- GCCTGAGTCATATAGCCTCTGG -3'

Sequencing Primer
(F):5'- AGTATCCATTCAGGCATGGC -3'
(R):5'- CCTCTGGCTTTTTAGAAGTAGAAG -3'
Posted On2018-08-29