Incidental Mutation 'R6774:Trim27'
ID532303
Institutional Source Beutler Lab
Gene Symbol Trim27
Ensembl Gene ENSMUSG00000021326
Gene Nametripartite motif-containing 27
SynonymsRfp
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location21179445-21194724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21192454 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 457 (H457Q)
Ref Sequence ENSEMBL: ENSMUSP00000152730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021761] [ENSMUST00000221464] [ENSMUST00000222544] [ENSMUST00000223065]
Predicted Effect probably damaging
Transcript: ENSMUST00000021761
AA Change: H457Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021761
Gene: ENSMUSG00000021326
AA Change: H457Q

DomainStartEndE-ValueType
RING 16 56 2.53e-6 SMART
BBOX 91 132 4.71e-15 SMART
low complexity region 146 170 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
PRY 315 367 7.09e-28 SMART
SPRY 368 493 1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139287
Predicted Effect probably damaging
Transcript: ENSMUST00000221464
AA Change: H281Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000222544
AA Change: H457Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223065
Meta Mutation Damage Score 0.0272 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nuclear matrix. It interacts with the enhancer of polycomb protein and represses gene transcription. It is also thought to be involved in the differentiation of male germ cells. Fusion of the N-terminus of this protein with the truncated C-terminus of the RET gene product has been shown to result in production of the ret transforming protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit exhibit increased potassium/calcium channel activity and TCR-stimulated calcium influx in Th1 and Th2 CD4 T cells. Mice homozygous for another gene trap allele exhibit decreased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Trim27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Trim27 APN 13 21192492 missense probably damaging 0.98
IGL02756:Trim27 APN 13 21190086 splice site probably benign
IGL03199:Trim27 APN 13 21191251 splice site probably null
R0016:Trim27 UTSW 13 21191229 missense probably benign 0.14
R0016:Trim27 UTSW 13 21191229 missense probably benign 0.14
R1709:Trim27 UTSW 13 21188065 critical splice donor site probably null
R2188:Trim27 UTSW 13 21183817 missense probably damaging 1.00
R4472:Trim27 UTSW 13 21189886 missense probably benign 0.00
R4657:Trim27 UTSW 13 21183760 missense probably damaging 1.00
R4677:Trim27 UTSW 13 21180916 critical splice donor site probably null
R5019:Trim27 UTSW 13 21189964 missense probably damaging 1.00
R5584:Trim27 UTSW 13 21192549 missense probably damaging 1.00
R6226:Trim27 UTSW 13 21180916 critical splice donor site probably benign
R7378:Trim27 UTSW 13 21192461 missense possibly damaging 0.92
X0062:Trim27 UTSW 13 21183874 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGGTGTCTGTGAAGACTCGG -3'
(R):5'- TACGTTCACTTCCTCACGGAG -3'

Sequencing Primer
(F):5'- CTGTGAAGACTCGGTGTGCAG -3'
(R):5'- GAGGTCTCCATGGAATGACC -3'
Posted On2018-08-29