Incidental Mutation 'R6774:Tfap2a'
ID532304
Institutional Source Beutler Lab
Gene Symbol Tfap2a
Ensembl Gene ENSMUSG00000021359
Gene Nametranscription factor AP-2, alpha
SynonymsTcfap2a, Ap2, Ap-2 (a), AP-2 alpha, Ap2tf, AP2alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6774 (G1)
Quality Score211.009
Status Validated
Chromosome13
Chromosomal Location40715302-40738376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40728754 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 25 (N25I)
Ref Sequence ENSEMBL: ENSMUSP00000153522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021787] [ENSMUST00000110193] [ENSMUST00000223869] [ENSMUST00000224665] [ENSMUST00000224999] [ENSMUST00000225180]
Predicted Effect probably damaging
Transcript: ENSMUST00000021787
AA Change: N17I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021787
Gene: ENSMUSG00000021359
AA Change: N17I

DomainStartEndE-ValueType
low complexity region 46 68 N/A INTRINSIC
low complexity region 82 95 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
Pfam:TF_AP-2 201 408 1.6e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110193
AA Change: N23I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105822
Gene: ENSMUSG00000021359
AA Change: N23I

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
low complexity region 88 101 N/A INTRINSIC
low complexity region 132 148 N/A INTRINSIC
Pfam:TF_AP-2 209 409 7.8e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181176
Predicted Effect probably damaging
Transcript: ENSMUST00000223869
AA Change: N19I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224319
Predicted Effect probably damaging
Transcript: ENSMUST00000224665
AA Change: N25I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224700
Predicted Effect probably damaging
Transcript: ENSMUST00000224999
AA Change: N25I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225180
AA Change: N52I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: This gene is a member of the activator protein 2 (AP-2) transcription factor family. The protein encoded by this gene can act as both an activator and repressor of gene transcription, and plays an important role in early embryogenesis, specifically in cranial development. This protein forms both homodimers and heterodimers, and binds to a GC-rich consensus sequence found in some promoters and enhancers. Disruption of this gene causes perinatal death, with neural tube, craniofacial, and limb mesenchyme defects. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mutants die perinatally with anencephaly, craniofacial and neural tube defects, thoraco-abdominoschisis and defects in sensory organs, cranial ganglia, skeleton, and heart. On some genetic backgrounds, heterozygotes may exhibit exencephaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Tfap2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4366001:Tfap2a UTSW 13 40721374 missense possibly damaging 0.67
R0124:Tfap2a UTSW 13 40717411 splice site probably benign
R0400:Tfap2a UTSW 13 40717412 splice site probably benign
R0486:Tfap2a UTSW 13 40728694 missense probably damaging 1.00
R1132:Tfap2a UTSW 13 40721391 splice site probably null
R1418:Tfap2a UTSW 13 40717204 missense possibly damaging 0.89
R1751:Tfap2a UTSW 13 40725137 missense probably damaging 1.00
R1767:Tfap2a UTSW 13 40725137 missense probably damaging 1.00
R1802:Tfap2a UTSW 13 40725170 missense probably damaging 1.00
R1865:Tfap2a UTSW 13 40728408 missense probably damaging 1.00
R4913:Tfap2a UTSW 13 40717230 missense probably damaging 1.00
R5764:Tfap2a UTSW 13 40728355 missense possibly damaging 0.64
R6378:Tfap2a UTSW 13 40723241 missense possibly damaging 0.48
R6496:Tfap2a UTSW 13 40728775 missense probably damaging 1.00
R6751:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6773:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6786:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R7027:Tfap2a UTSW 13 40733674 missense probably benign 0.02
R7140:Tfap2a UTSW 13 40730047 missense probably benign 0.19
R7268:Tfap2a UTSW 13 40728760 missense possibly damaging 0.91
R7299:Tfap2a UTSW 13 40721308 missense probably damaging 1.00
R7301:Tfap2a UTSW 13 40721308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTAAGAGCCCAGATTCCTG -3'
(R):5'- AAAGGCCTGCTTCACTTCTTG -3'

Sequencing Primer
(F):5'- CGTGCAGAGGATTCAGGCTG -3'
(R):5'- CTTGGGTGTTTTCCAATATGAACAG -3'
Posted On2018-08-29