Incidental Mutation 'R6774:Zfp712'
ID532305
Institutional Source Beutler Lab
Gene Symbol Zfp712
Ensembl Gene ENSMUSG00000090641
Gene Namezinc finger protein 712
Synonyms4921504N20Rik, mszf31, mszf89
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67038596-67061170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67041504 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 320 (T320A)
Ref Sequence ENSEMBL: ENSMUSP00000126665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167565]
Predicted Effect probably benign
Transcript: ENSMUST00000167565
AA Change: T320A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126665
Gene: ENSMUSG00000090641
AA Change: T320A

DomainStartEndE-ValueType
KRAB 5 65 7.38e-36 SMART
ZnF_C2H2 109 131 1.28e-3 SMART
ZnF_C2H2 137 159 4.17e-3 SMART
ZnF_C2H2 165 186 1.73e0 SMART
ZnF_C2H2 192 214 3.39e-3 SMART
ZnF_C2H2 220 242 1.58e-3 SMART
ZnF_C2H2 248 270 8.34e-3 SMART
ZnF_C2H2 276 298 4.17e-3 SMART
ZnF_C2H2 304 326 4.87e-4 SMART
ZnF_C2H2 332 354 1.04e-3 SMART
ZnF_C2H2 360 382 5.5e-3 SMART
ZnF_C2H2 388 410 1.89e-1 SMART
ZnF_C2H2 416 438 7.15e-2 SMART
ZnF_C2H2 444 466 3.58e-2 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 2.12e-4 SMART
ZnF_C2H2 528 550 3.83e-2 SMART
ZnF_C2H2 556 578 2.95e-3 SMART
ZnF_C2H2 584 606 6.32e-3 SMART
ZnF_C2H2 612 634 3.89e-3 SMART
ZnF_C2H2 640 662 3.49e-5 SMART
ZnF_C2H2 668 690 1.84e-4 SMART
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Other mutations in Zfp712
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Zfp712 APN 13 67042166 missense possibly damaging 0.55
IGL02148:Zfp712 APN 13 67042158 missense probably damaging 1.00
R0085:Zfp712 UTSW 13 67041192 missense probably benign 0.00
R0332:Zfp712 UTSW 13 67040813 missense probably damaging 1.00
R1676:Zfp712 UTSW 13 67052336 missense probably benign 0.00
R1838:Zfp712 UTSW 13 67042047 missense probably damaging 1.00
R1997:Zfp712 UTSW 13 67042050 nonsense probably null
R2147:Zfp712 UTSW 13 67041896 missense possibly damaging 0.94
R2203:Zfp712 UTSW 13 67041984 missense probably benign 0.32
R3421:Zfp712 UTSW 13 67052392 missense probably damaging 0.98
R3943:Zfp712 UTSW 13 67041332 missense probably benign 0.06
R4722:Zfp712 UTSW 13 67042113 missense probably benign 0.41
R4952:Zfp712 UTSW 13 67040841 missense possibly damaging 0.63
R4964:Zfp712 UTSW 13 67040612 missense probably damaging 1.00
R4966:Zfp712 UTSW 13 67040612 missense probably damaging 1.00
R4967:Zfp712 UTSW 13 67040709 nonsense probably null
R5114:Zfp712 UTSW 13 67041361 missense probably damaging 1.00
R5361:Zfp712 UTSW 13 67041015 missense possibly damaging 0.95
R5922:Zfp712 UTSW 13 67041604 missense probably benign 0.01
R5950:Zfp712 UTSW 13 67044817 missense probably damaging 0.99
R6004:Zfp712 UTSW 13 67041705 missense probably damaging 1.00
R6236:Zfp712 UTSW 13 67040621 missense probably damaging 1.00
R6298:Zfp712 UTSW 13 67041329 missense probably damaging 1.00
R6499:Zfp712 UTSW 13 67052336 missense probably benign 0.00
R6932:Zfp712 UTSW 13 67040827 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACGTCTGGCCACACTCTTC -3'
(R):5'- TGGCAAGACCTTTAATTTTCCCAC -3'

Sequencing Primer
(F):5'- GGCCACACTCTTCACATTTATAAGG -3'
(R):5'- TTCTCAGCATCAGAGAATTCACACTG -3'
Posted On2018-08-29