Incidental Mutation 'R6786:Adnp2'
ID532407
Institutional Source Beutler Lab
Gene Symbol Adnp2
Ensembl Gene ENSMUSG00000053950
Gene NameADNP homeobox 2
SynonymsZfp508, 8430420L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6786 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location80126311-80151482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80129745 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 483 (V483A)
Ref Sequence ENSEMBL: ENSMUSP00000068560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066743]
Predicted Effect probably benign
Transcript: ENSMUST00000066743
AA Change: V483A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000068560
Gene: ENSMUSG00000053950
AA Change: V483A

DomainStartEndE-ValueType
ZnF_C2H2 73 96 4.57e0 SMART
ZnF_C2H2 106 128 1.06e2 SMART
ZnF_C2H2 155 178 5.48e0 SMART
ZnF_C2H2 215 240 7.29e0 SMART
low complexity region 277 290 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 333 355 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
low complexity region 625 648 N/A INTRINSIC
low complexity region 656 674 N/A INTRINSIC
ZnF_C2H2 696 718 9.96e0 SMART
ZnF_C2H2 724 746 4.99e1 SMART
low complexity region 747 761 N/A INTRINSIC
ZnF_C2H2 777 798 1.93e2 SMART
ZnF_C2H2 800 823 4.34e0 SMART
ZnF_C2H2 905 928 5.81e-2 SMART
HOX 1073 1135 3.25e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a C A 4: 56,744,116 Y214* probably null Het
Aif1 C T 17: 35,171,496 V93M probably damaging Het
Alpk2 A G 18: 65,306,634 S563P probably benign Het
Ank2 A T 3: 126,958,932 N378K probably damaging Het
Ano4 C T 10: 88,992,870 probably null Het
Asxl3 G A 18: 22,525,440 C2169Y probably damaging Het
Atp2b1 T C 10: 99,016,959 C101R probably damaging Het
BC052040 A G 2: 115,631,981 I65V probably benign Het
Bcs1l C T 1: 74,590,685 R224C probably damaging Het
Car2 T C 3: 14,886,650 probably benign Het
Cbln1 T C 8: 87,472,029 N71S probably benign Het
Cdh8 T A 8: 99,223,947 T224S probably benign Het
Cep131 G A 11: 120,065,392 R1014W probably damaging Het
Cfap61 T C 2: 146,045,443 S603P possibly damaging Het
Chd8 G T 14: 52,226,668 L659I probably benign Het
Ckap5 G A 2: 91,557,575 G255D probably benign Het
Clec18a C A 8: 111,080,940 W126L probably benign Het
Cux1 T A 5: 136,567,231 N4Y probably damaging Het
Dgcr8 A T 16: 18,283,829 Y196* probably null Het
Dnah14 A T 1: 181,641,405 I1267F probably benign Het
Dock7 T C 4: 99,061,292 N438D probably benign Het
Dock8 A T 19: 25,183,022 H1763L possibly damaging Het
Fpr-rs6 A T 17: 20,182,838 M87K possibly damaging Het
Gabrg1 A G 5: 70,754,267 S339P probably benign Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm11487 A T 4: 73,403,606 M64K possibly damaging Het
Gm12695 A G 4: 96,762,821 S132P probably damaging Het
Gm3443 T A 19: 21,555,764 C31S probably damaging Het
Gm9573 T C 17: 35,623,165 probably benign Het
Gzmf A T 14: 56,206,995 F40L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Ikbkap T C 4: 56,771,555 D914G possibly damaging Het
Lrguk A G 6: 34,095,587 E604G probably benign Het
Marveld3 C A 8: 109,948,100 K361N probably benign Het
Mgat4b A T 11: 50,230,698 Y47F probably damaging Het
Mmel1 G T 4: 154,892,428 E520* probably null Het
Myod1 A G 7: 46,378,317 T294A probably benign Het
Nfix A T 8: 84,727,647 S219T probably damaging Het
Nr4a2 A G 2: 57,111,908 F115L probably benign Het
Numa1 A C 7: 101,992,638 M98L probably benign Het
Olfr1458 T C 19: 13,103,203 I28V probably benign Het
P3h1 C T 4: 119,237,954 L303F possibly damaging Het
Pias4 G A 10: 81,157,246 T5I probably damaging Het
Pik3ip1 A G 11: 3,332,124 N68S probably benign Het
Pkdrej T C 15: 85,818,649 T1029A probably benign Het
Recql A T 6: 142,364,552 D517E probably benign Het
Sall2 G T 14: 52,314,621 H372Q probably damaging Het
Scn8a A C 15: 101,032,215 I1436L probably benign Het
Slc4a5 T C 6: 83,296,747 probably null Het
Stox2 A C 8: 47,186,465 F898C probably damaging Het
Sumo2 A T 11: 115,523,775 probably null Het
Sycp2 C T 2: 178,383,552 E366K possibly damaging Het
Tanc1 A G 2: 59,791,806 K423R probably benign Het
Tbx21 T A 11: 97,115,046 Q31L possibly damaging Het
Tcrg-C1 A T 13: 19,216,476 D125V unknown Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Trav18 G A 14: 53,831,665 V55I probably benign Het
Trim55 A G 3: 19,672,774 D335G probably benign Het
Trim71 T A 9: 114,512,704 T837S probably benign Het
Vmn1r56 T C 7: 5,195,962 T219A probably benign Het
Vmn2r17 A T 5: 109,427,829 T189S probably benign Het
Xaf1 A G 11: 72,306,635 T146A probably benign Het
Zdbf2 T C 1: 63,304,520 V686A possibly damaging Het
Zfp65 T C 13: 67,708,011 H383R probably damaging Het
Zfp932 A G 5: 110,009,740 T435A probably damaging Het
Zfp947 C T 17: 22,145,769 G308D probably benign Het
Zswim3 T A 2: 164,820,851 V417E probably damaging Het
Other mutations in Adnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Adnp2 APN 18 80128867 missense probably benign 0.00
IGL00730:Adnp2 APN 18 80128032 missense probably benign
IGL01615:Adnp2 APN 18 80128477 missense probably damaging 1.00
IGL01681:Adnp2 APN 18 80127888 missense probably damaging 1.00
IGL02549:Adnp2 APN 18 80129118 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0013:Adnp2 UTSW 18 80129745 missense probably damaging 0.99
R0013:Adnp2 UTSW 18 80129745 missense probably damaging 0.99
R0325:Adnp2 UTSW 18 80130653 missense probably benign 0.06
R0478:Adnp2 UTSW 18 80129334 missense probably benign 0.31
R0545:Adnp2 UTSW 18 80129401 missense probably benign 0.31
R0788:Adnp2 UTSW 18 80130004 missense probably benign
R1756:Adnp2 UTSW 18 80127697 makesense probably null
R2043:Adnp2 UTSW 18 80128326 missense probably damaging 1.00
R2121:Adnp2 UTSW 18 80129170 missense probably benign 0.00
R2260:Adnp2 UTSW 18 80128449 missense probably benign 0.01
R2374:Adnp2 UTSW 18 80130987 missense probably damaging 1.00
R3416:Adnp2 UTSW 18 80128158 missense possibly damaging 0.55
R3607:Adnp2 UTSW 18 80129069 missense probably damaging 1.00
R4012:Adnp2 UTSW 18 80130821 missense probably benign 0.01
R4260:Adnp2 UTSW 18 80137527 missense possibly damaging 0.85
R4588:Adnp2 UTSW 18 80128648 missense probably benign 0.22
R5158:Adnp2 UTSW 18 80137543 missense probably damaging 0.99
R5652:Adnp2 UTSW 18 80130850 missense probably damaging 1.00
R5717:Adnp2 UTSW 18 80128264 missense probably benign 0.13
R6743:Adnp2 UTSW 18 80128059 missense probably benign 0.00
R6903:Adnp2 UTSW 18 80130090 missense probably benign
R7105:Adnp2 UTSW 18 80128151 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACTCCTGGTGTTACTGGCTG -3'
(R):5'- GGACTTTTACCCCTCACTAAGC -3'

Sequencing Primer
(F):5'- GCTGAAGAACGCCAGAGTTTACAC -3'
(R):5'- GCCCATGAACAGACCTGTG -3'
Posted On2018-08-29