Incidental Mutation 'R6787:Polr3b'
ID532442
Institutional Source Beutler Lab
Gene Symbol Polr3b
Ensembl Gene ENSMUSG00000034453
Gene Namepolymerase (RNA) III (DNA directed) polypeptide B
SynonymsRPC2, A330032P03Rik, 2700078H01Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027423

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6787 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location84622292-84727178 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to C at 84628625 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077175]
Predicted Effect probably null
Transcript: ENSMUST00000077175
SMART Domains Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 38 413 2e-55 PFAM
Pfam:RNA_pol_Rpb2_2 185 363 8.4e-29 PFAM
Pfam:RNA_pol_Rpb2_3 438 502 2.6e-22 PFAM
Pfam:RNA_pol_Rpb2_4 539 600 1e-29 PFAM
Pfam:RNA_pol_Rpb2_5 621 661 6.5e-14 PFAM
Pfam:RNA_pol_Rpb2_6 668 1041 5.8e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1043 1129 7.6e-36 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G A 12: 55,079,983 T32I probably benign Het
4930486L24Rik T A 13: 60,853,108 I205L probably benign Het
Aatk C T 11: 120,010,682 V963M probably damaging Het
Adra1b C A 11: 43,835,415 R225L probably damaging Het
Adrb1 T C 19: 56,722,589 V73A probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
BC035947 G T 1: 78,498,890 P335Q possibly damaging Het
C2cd3 T C 7: 100,455,346 F2189L probably benign Het
Capn9 A G 8: 124,616,185 I635V probably benign Het
Cep55 T A 19: 38,057,926 D42E probably benign Het
Cftr T A 6: 18,274,608 Y878* probably null Het
Clpb A T 7: 101,663,659 probably benign Het
Cpeb3 T C 19: 37,044,689 I569V possibly damaging Het
Cpne6 A T 14: 55,515,244 D297V probably damaging Het
Ddhd1 T C 14: 45,657,519 T165A probably benign Het
Fam98b T C 2: 117,262,921 probably null Het
Frem2 T C 3: 53,654,323 N921S probably benign Het
Gbf1 T A 19: 46,271,772 V1039E probably benign Het
Gmip A G 8: 69,813,786 E212G probably damaging Het
Gpcpd1 C T 2: 132,537,838 probably benign Het
Gtf2ird1 A T 5: 134,363,912 N796K probably damaging Het
Hadhb T C 5: 30,155,249 probably benign Het
Itga4 T A 2: 79,289,265 S472T probably damaging Het
Kcna4 G A 2: 107,295,325 E135K possibly damaging Het
Kmt2c G T 5: 25,275,739 probably null Het
Lama1 T C 17: 67,784,025 I1620T unknown Het
Lins1 A G 7: 66,714,154 E594G probably benign Het
Lrrc38 T A 4: 143,369,794 M225K probably benign Het
Mphosph9 A G 5: 124,261,027 I975T probably damaging Het
Mrgprh T C 17: 12,876,987 F38S probably benign Het
Myo1h G A 5: 114,320,653 G150R probably damaging Het
Oas2 T G 5: 120,738,798 I391L possibly damaging Het
Olfr1242 T A 2: 89,494,034 R93* probably null Het
Olfr18 T C 9: 20,335,925 D14G probably benign Het
Olfr497 T C 7: 108,422,682 I37T possibly damaging Het
Olfr803 T A 10: 129,691,522 D173V possibly damaging Het
Pdcd5 T C 7: 35,642,638 T182A probably damaging Het
Pdlim7 T C 13: 55,508,997 D48G probably damaging Het
Psmd5 C T 2: 34,857,637 probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sdhb T C 4: 140,976,190 Y208H probably damaging Het
Serinc5 G A 13: 92,706,232 V397I possibly damaging Het
Sik2 A T 9: 50,998,534 M73K possibly damaging Het
Slc41a1 A G 1: 131,842,749 probably null Het
Slco1a1 T C 6: 141,936,487 I119V probably benign Het
Srd5a1 T C 13: 69,611,299 probably benign Het
Stab2 T C 10: 86,919,084 I1111V probably benign Het
Stxbp6 G T 12: 44,902,996 probably null Het
Tbc1d19 A G 5: 53,835,249 probably null Het
Tnxb A T 17: 34,710,736 T2815S probably benign Het
Txnip T A 3: 96,560,307 I363N probably damaging Het
Zfp442 A T 2: 150,409,579 N134K possibly damaging Het
Other mutations in Polr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Polr3b APN 10 84676990 missense probably benign
IGL00848:Polr3b APN 10 84680377 missense probably damaging 1.00
IGL00901:Polr3b APN 10 84631796 missense possibly damaging 0.94
IGL01313:Polr3b APN 10 84725743 missense probably damaging 1.00
IGL01364:Polr3b APN 10 84695669 missense probably benign 0.00
IGL01731:Polr3b APN 10 84631840 nonsense probably null
IGL03326:Polr3b APN 10 84667395 missense probably benign 0.43
IGL03369:Polr3b APN 10 84676952 missense probably damaging 1.00
etruscan UTSW 10 84632538 missense probably benign 0.00
pennyweight UTSW 10 84713632 missense probably damaging 1.00
G5538:Polr3b UTSW 10 84631794 missense probably benign 0.21
PIT4382001:Polr3b UTSW 10 84684185 missense probably damaging 1.00
R0180:Polr3b UTSW 10 84622515 missense probably benign
R0270:Polr3b UTSW 10 84718475 missense probably benign 0.02
R0541:Polr3b UTSW 10 84638064 missense probably damaging 1.00
R0890:Polr3b UTSW 10 84714336 missense probably benign 0.01
R1302:Polr3b UTSW 10 84632486 missense probably damaging 0.97
R1511:Polr3b UTSW 10 84680385 missense probably benign
R1561:Polr3b UTSW 10 84634912 missense probably damaging 1.00
R1607:Polr3b UTSW 10 84652783 missense probably benign 0.00
R1624:Polr3b UTSW 10 84679805 missense probably damaging 0.98
R1809:Polr3b UTSW 10 84693001 missense probably damaging 1.00
R1830:Polr3b UTSW 10 84692922 nonsense probably null
R2973:Polr3b UTSW 10 84628280 missense probably benign 0.00
R3401:Polr3b UTSW 10 84699491 missense probably damaging 0.96
R3876:Polr3b UTSW 10 84720518 critical splice donor site probably null
R3961:Polr3b UTSW 10 84684302 missense possibly damaging 0.89
R4664:Polr3b UTSW 10 84714369 missense probably damaging 1.00
R4721:Polr3b UTSW 10 84656003 missense possibly damaging 0.56
R4972:Polr3b UTSW 10 84638124 missense probably damaging 1.00
R5065:Polr3b UTSW 10 84632538 missense probably benign 0.00
R5264:Polr3b UTSW 10 84667416 missense probably benign 0.02
R5302:Polr3b UTSW 10 84699400 missense possibly damaging 0.59
R5795:Polr3b UTSW 10 84628252 missense probably benign
R5795:Polr3b UTSW 10 84677011 missense probably damaging 0.97
R5838:Polr3b UTSW 10 84674590 missense probably benign 0.09
R6419:Polr3b UTSW 10 84638111 missense possibly damaging 0.78
R6568:Polr3b UTSW 10 84634903 missense probably damaging 1.00
R6913:Polr3b UTSW 10 84713632 missense probably damaging 1.00
X0066:Polr3b UTSW 10 84713695 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAAACACTAATGGTTACCTGCC -3'
(R):5'- AGTTTACTAGACAGATACAGTAGTGG -3'

Sequencing Primer
(F):5'- TAATGGTTACCTGCCCCAGAGTG -3'
(R):5'- GTGGTATTACAAGAGATTTGACAGC -3'
Posted On2018-08-29