Incidental Mutation 'R6787:Cpne6'
ID532453
Institutional Source Beutler Lab
Gene Symbol Cpne6
Ensembl Gene ENSMUSG00000022212
Gene Namecopine VI
Synonymsneuronal copine
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R6787 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55510445-55517431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55515244 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 297 (D297V)
Ref Sequence ENSEMBL: ENSMUSP00000128555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062232] [ENSMUST00000074225] [ENSMUST00000111404] [ENSMUST00000163767] [ENSMUST00000165262] [ENSMUST00000165725] [ENSMUST00000171643] [ENSMUST00000178694]
Predicted Effect probably benign
Transcript: ENSMUST00000062232
SMART Domains Protein: ENSMUSP00000054457
Gene: ENSMUSG00000040632

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 101 7.3e-18 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000074225
AA Change: D297V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073847
Gene: ENSMUSG00000022212
AA Change: D297V

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111404
SMART Domains Protein: ENSMUSP00000107035
Gene: ENSMUSG00000040632

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 102 2e-15 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163767
AA Change: D297V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126493
Gene: ENSMUSG00000022212
AA Change: D297V

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165262
AA Change: D297V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132999
Gene: ENSMUSG00000022212
AA Change: D297V

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 505 2.34e-14 SMART
low complexity region 542 556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165725
SMART Domains Protein: ENSMUSP00000130799
Gene: ENSMUSG00000022212

DomainStartEndE-ValueType
C2 21 126 1.22e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171643
AA Change: D297V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128555
Gene: ENSMUSG00000022212
AA Change: D297V

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178694
SMART Domains Protein: ENSMUSP00000136445
Gene: ENSMUSG00000040632

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 102 2e-15 PFAM
BRLZ 157 221 1.6e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G A 12: 55,079,983 T32I probably benign Het
4930486L24Rik T A 13: 60,853,108 I205L probably benign Het
Aatk C T 11: 120,010,682 V963M probably damaging Het
Adra1b C A 11: 43,835,415 R225L probably damaging Het
Adrb1 T C 19: 56,722,589 V73A probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
BC035947 G T 1: 78,498,890 P335Q possibly damaging Het
C2cd3 T C 7: 100,455,346 F2189L probably benign Het
Capn9 A G 8: 124,616,185 I635V probably benign Het
Cep55 T A 19: 38,057,926 D42E probably benign Het
Cftr T A 6: 18,274,608 Y878* probably null Het
Clpb A T 7: 101,663,659 probably benign Het
Cpeb3 T C 19: 37,044,689 I569V possibly damaging Het
Ddhd1 T C 14: 45,657,519 T165A probably benign Het
Fam98b T C 2: 117,262,921 probably null Het
Frem2 T C 3: 53,654,323 N921S probably benign Het
Gbf1 T A 19: 46,271,772 V1039E probably benign Het
Gmip A G 8: 69,813,786 E212G probably damaging Het
Gpcpd1 C T 2: 132,537,838 probably benign Het
Gtf2ird1 A T 5: 134,363,912 N796K probably damaging Het
Hadhb T C 5: 30,155,249 probably benign Het
Itga4 T A 2: 79,289,265 S472T probably damaging Het
Kcna4 G A 2: 107,295,325 E135K possibly damaging Het
Kmt2c G T 5: 25,275,739 probably null Het
Lama1 T C 17: 67,784,025 I1620T unknown Het
Lins1 A G 7: 66,714,154 E594G probably benign Het
Lrrc38 T A 4: 143,369,794 M225K probably benign Het
Mphosph9 A G 5: 124,261,027 I975T probably damaging Het
Mrgprh T C 17: 12,876,987 F38S probably benign Het
Myo1h G A 5: 114,320,653 G150R probably damaging Het
Oas2 T G 5: 120,738,798 I391L possibly damaging Het
Olfr1242 T A 2: 89,494,034 R93* probably null Het
Olfr18 T C 9: 20,335,925 D14G probably benign Het
Olfr497 T C 7: 108,422,682 I37T possibly damaging Het
Olfr803 T A 10: 129,691,522 D173V possibly damaging Het
Pdcd5 T C 7: 35,642,638 T182A probably damaging Het
Pdlim7 T C 13: 55,508,997 D48G probably damaging Het
Polr3b A C 10: 84,628,625 probably null Het
Psmd5 C T 2: 34,857,637 probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sdhb T C 4: 140,976,190 Y208H probably damaging Het
Serinc5 G A 13: 92,706,232 V397I possibly damaging Het
Sik2 A T 9: 50,998,534 M73K possibly damaging Het
Slc41a1 A G 1: 131,842,749 probably null Het
Slco1a1 T C 6: 141,936,487 I119V probably benign Het
Srd5a1 T C 13: 69,611,299 probably benign Het
Stab2 T C 10: 86,919,084 I1111V probably benign Het
Stxbp6 G T 12: 44,902,996 probably null Het
Tbc1d19 A G 5: 53,835,249 probably null Het
Tnxb A T 17: 34,710,736 T2815S probably benign Het
Txnip T A 3: 96,560,307 I363N probably damaging Het
Zfp442 A T 2: 150,409,579 N134K possibly damaging Het
Other mutations in Cpne6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Cpne6 APN 14 55512730 missense probably damaging 1.00
IGL01306:Cpne6 APN 14 55515249 missense probably damaging 1.00
IGL01548:Cpne6 APN 14 55512726 missense probably damaging 0.99
IGL01867:Cpne6 APN 14 55513680 missense probably benign 0.16
IGL01902:Cpne6 APN 14 55512750 missense possibly damaging 0.80
IGL02669:Cpne6 APN 14 55513826 missense probably benign 0.09
IGL02695:Cpne6 APN 14 55514580 missense probably damaging 1.00
IGL03082:Cpne6 APN 14 55516303 missense probably damaging 1.00
ANU23:Cpne6 UTSW 14 55512002 missense probably benign 0.05
ANU23:Cpne6 UTSW 14 55515249 missense probably damaging 1.00
R0504:Cpne6 UTSW 14 55514602 missense probably damaging 0.99
R1472:Cpne6 UTSW 14 55514635 missense probably benign 0.00
R1538:Cpne6 UTSW 14 55515220 missense possibly damaging 0.92
R1898:Cpne6 UTSW 14 55517028 missense possibly damaging 0.88
R2679:Cpne6 UTSW 14 55516329 missense possibly damaging 0.94
R4235:Cpne6 UTSW 14 55513600 intron probably benign
R4453:Cpne6 UTSW 14 55512597 missense probably damaging 1.00
R4471:Cpne6 UTSW 14 55516632 missense probably damaging 1.00
R4823:Cpne6 UTSW 14 55517010 missense probably damaging 1.00
R5171:Cpne6 UTSW 14 55512148 missense possibly damaging 0.71
R5243:Cpne6 UTSW 14 55512747 missense probably damaging 1.00
R5999:Cpne6 UTSW 14 55513059 missense probably benign
R6111:Cpne6 UTSW 14 55514634 missense probably benign 0.18
R6475:Cpne6 UTSW 14 55513653 missense probably damaging 1.00
R6535:Cpne6 UTSW 14 55513665 missense probably benign 0.30
R7318:Cpne6 UTSW 14 55514294 missense possibly damaging 0.95
R7453:Cpne6 UTSW 14 55512016 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CCTGCTCTGGGAATTGAAATTGTG -3'
(R):5'- ATGCGGCATCCATGAGAACC -3'

Sequencing Primer
(F):5'- TGAAATTGTGAACACTTGCTCCACC -3'
(R):5'- GGCATCCATGAGAACCAACAGG -3'
Posted On2018-08-29